ID: 1171849312

View in Genome Browser
Species Human (GRCh38)
Location 20:30296762-30296784
Sequence ATAAGCAGGGCCCATTTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171849305_1171849312 26 Left 1171849305 20:30296713-30296735 CCTCATCCAGCACCAGAGAGGGA No data
Right 1171849312 20:30296762-30296784 ATAAGCAGGGCCCATTTACCAGG No data
1171849309_1171849312 14 Left 1171849309 20:30296725-30296747 CCAGAGAGGGAGGGATAAAAATT No data
Right 1171849312 20:30296762-30296784 ATAAGCAGGGCCCATTTACCAGG No data
1171849308_1171849312 20 Left 1171849308 20:30296719-30296741 CCAGCACCAGAGAGGGAGGGATA No data
Right 1171849312 20:30296762-30296784 ATAAGCAGGGCCCATTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171849312 Original CRISPR ATAAGCAGGGCCCATTTACC AGG Intergenic
No off target data available for this crispr