ID: 1171850896

View in Genome Browser
Species Human (GRCh38)
Location 20:30307158-30307180
Sequence GAACCCAAGTTGGGACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171850887_1171850896 18 Left 1171850887 20:30307117-30307139 CCAGGTGAAAGACTATGAGCCAG No data
Right 1171850896 20:30307158-30307180 GAACCCAAGTTGGGACAGGCAGG No data
1171850885_1171850896 29 Left 1171850885 20:30307106-30307128 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1171850896 20:30307158-30307180 GAACCCAAGTTGGGACAGGCAGG No data
1171850886_1171850896 19 Left 1171850886 20:30307116-30307138 CCCAGGTGAAAGACTATGAGCCA No data
Right 1171850896 20:30307158-30307180 GAACCCAAGTTGGGACAGGCAGG No data
1171850884_1171850896 30 Left 1171850884 20:30307105-30307127 CCCAGAGAAAGCCCAGGTGAAAG No data
Right 1171850896 20:30307158-30307180 GAACCCAAGTTGGGACAGGCAGG No data
1171850892_1171850896 -1 Left 1171850892 20:30307136-30307158 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1171850896 20:30307158-30307180 GAACCCAAGTTGGGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171850896 Original CRISPR GAACCCAAGTTGGGACAGGC AGG Intergenic
No off target data available for this crispr