ID: 1171851019

View in Genome Browser
Species Human (GRCh38)
Location 20:30308039-30308061
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171851017_1171851019 -4 Left 1171851017 20:30308020-30308042 CCTAACTCTGCTTCAACTTGCCC No data
Right 1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG No data
1171851014_1171851019 21 Left 1171851014 20:30307995-30308017 CCTCAGCAGAGGGACCTGGATCT No data
Right 1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG No data
1171851016_1171851019 -3 Left 1171851016 20:30308019-30308041 CCCTAACTCTGCTTCAACTTGCC No data
Right 1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG No data
1171851015_1171851019 7 Left 1171851015 20:30308009-30308031 CCTGGATCTTCCCTAACTCTGCT No data
Right 1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG No data
1171851013_1171851019 22 Left 1171851013 20:30307994-30308016 CCCTCAGCAGAGGGACCTGGATC No data
Right 1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171851019 Original CRISPR GCCCCAGGCATTATTTCCCC AGG Intergenic