ID: 1171851035

View in Genome Browser
Species Human (GRCh38)
Location 20:30308078-30308100
Sequence GGCCTGGAGTTCCCTGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171851035_1171851041 16 Left 1171851035 20:30308078-30308100 CCTGTTGCAGGGAACTCCAGGCC No data
Right 1171851041 20:30308117-30308139 ATTTTGGCGTACATTAAGGTGGG No data
1171851035_1171851038 0 Left 1171851035 20:30308078-30308100 CCTGTTGCAGGGAACTCCAGGCC No data
Right 1171851038 20:30308101-30308123 TTCAACAAGCAGAACTATTTTGG No data
1171851035_1171851040 15 Left 1171851035 20:30308078-30308100 CCTGTTGCAGGGAACTCCAGGCC No data
Right 1171851040 20:30308116-30308138 TATTTTGGCGTACATTAAGGTGG No data
1171851035_1171851039 12 Left 1171851035 20:30308078-30308100 CCTGTTGCAGGGAACTCCAGGCC No data
Right 1171851039 20:30308113-30308135 AACTATTTTGGCGTACATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171851035 Original CRISPR GGCCTGGAGTTCCCTGCAAC AGG (reversed) Intergenic
No off target data available for this crispr