ID: 1171853612

View in Genome Browser
Species Human (GRCh38)
Location 20:30325517-30325539
Sequence GGCTGTGTCTGAAGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171853606_1171853612 5 Left 1171853606 20:30325489-30325511 CCAGGCAGAGGGCAGCTTGAGGG No data
Right 1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG No data
1171853601_1171853612 28 Left 1171853601 20:30325466-30325488 CCAGCTCACAAGGAAGGTGGGAT No data
Right 1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171853612 Original CRISPR GGCTGTGTCTGAAGGGCAGC AGG Intergenic
No off target data available for this crispr