ID: 1171853612 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:30325517-30325539 |
Sequence | GGCTGTGTCTGAAGGGCAGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1171853606_1171853612 | 5 | Left | 1171853606 | 20:30325489-30325511 | CCAGGCAGAGGGCAGCTTGAGGG | No data | ||
Right | 1171853612 | 20:30325517-30325539 | GGCTGTGTCTGAAGGGCAGCAGG | No data | ||||
1171853601_1171853612 | 28 | Left | 1171853601 | 20:30325466-30325488 | CCAGCTCACAAGGAAGGTGGGAT | No data | ||
Right | 1171853612 | 20:30325517-30325539 | GGCTGTGTCTGAAGGGCAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1171853612 | Original CRISPR | GGCTGTGTCTGAAGGGCAGC AGG | Intergenic | ||
No off target data available for this crispr |