ID: 1171860690

View in Genome Browser
Species Human (GRCh38)
Location 20:30400182-30400204
Sequence ACATGGCATCTGTACAATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171860684_1171860690 11 Left 1171860684 20:30400148-30400170 CCTTTAAATTCCTTCTGTCACCA No data
Right 1171860690 20:30400182-30400204 ACATGGCATCTGTACAATCTGGG No data
1171860683_1171860690 26 Left 1171860683 20:30400133-30400155 CCTATCTAGTTCTAGCCTTTAAA No data
Right 1171860690 20:30400182-30400204 ACATGGCATCTGTACAATCTGGG No data
1171860682_1171860690 27 Left 1171860682 20:30400132-30400154 CCCTATCTAGTTCTAGCCTTTAA No data
Right 1171860690 20:30400182-30400204 ACATGGCATCTGTACAATCTGGG No data
1171860686_1171860690 1 Left 1171860686 20:30400158-30400180 CCTTCTGTCACCAAATCTGGAGT No data
Right 1171860690 20:30400182-30400204 ACATGGCATCTGTACAATCTGGG No data
1171860688_1171860690 -9 Left 1171860688 20:30400168-30400190 CCAAATCTGGAGTTACATGGCAT No data
Right 1171860690 20:30400182-30400204 ACATGGCATCTGTACAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171860690 Original CRISPR ACATGGCATCTGTACAATCT GGG Intergenic
No off target data available for this crispr