ID: 1171862288

View in Genome Browser
Species Human (GRCh38)
Location 20:30412278-30412300
Sequence AAGTCCTTCTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171862286_1171862288 2 Left 1171862286 20:30412253-30412275 CCATGGAAAAAGGACCTATCAAA No data
Right 1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG No data
1171862284_1171862288 15 Left 1171862284 20:30412240-30412262 CCTTTATTCTAAACCATGGAAAA No data
Right 1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG No data
1171862283_1171862288 18 Left 1171862283 20:30412237-30412259 CCTCCTTTATTCTAAACCATGGA No data
Right 1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171862288 Original CRISPR AAGTCCTTCTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr