ID: 1171865795

View in Genome Browser
Species Human (GRCh38)
Location 20:30486842-30486864
Sequence TTTCTTGGAAGCTGCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171865787_1171865795 6 Left 1171865787 20:30486813-30486835 CCCTCGGAACTGAAAAACCCAAA No data
Right 1171865795 20:30486842-30486864 TTTCTTGGAAGCTGCCCAGCGGG No data
1171865785_1171865795 14 Left 1171865785 20:30486805-30486827 CCATACTCCCCTCGGAACTGAAA No data
Right 1171865795 20:30486842-30486864 TTTCTTGGAAGCTGCCCAGCGGG No data
1171865788_1171865795 5 Left 1171865788 20:30486814-30486836 CCTCGGAACTGAAAAACCCAAAG No data
Right 1171865795 20:30486842-30486864 TTTCTTGGAAGCTGCCCAGCGGG No data
1171865786_1171865795 7 Left 1171865786 20:30486812-30486834 CCCCTCGGAACTGAAAAACCCAA No data
Right 1171865795 20:30486842-30486864 TTTCTTGGAAGCTGCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171865795 Original CRISPR TTTCTTGGAAGCTGCCCAGC GGG Intergenic
No off target data available for this crispr