ID: 1171866129

View in Genome Browser
Species Human (GRCh38)
Location 20:30488516-30488538
Sequence GGTCCCAAAGGCGCACGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171866109_1171866129 27 Left 1171866109 20:30488466-30488488 CCCCAAACCCTCCGGGTGCCCAC No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866112_1171866129 20 Left 1171866112 20:30488473-30488495 CCCTCCGGGTGCCCACCACGCCC No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866119_1171866129 8 Left 1171866119 20:30488485-30488507 CCACCACGCCCACTCGGGGTGCC No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866111_1171866129 25 Left 1171866111 20:30488468-30488490 CCAAACCCTCCGGGTGCCCACCA No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866113_1171866129 19 Left 1171866113 20:30488474-30488496 CCTCCGGGTGCCCACCACGCCCA No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866121_1171866129 0 Left 1171866121 20:30488493-30488515 CCCACTCGGGGTGCCGCCGACCT No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866122_1171866129 -1 Left 1171866122 20:30488494-30488516 CCACTCGGGGTGCCGCCGACCTG No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866114_1171866129 16 Left 1171866114 20:30488477-30488499 CCGGGTGCCCACCACGCCCACTC No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866118_1171866129 9 Left 1171866118 20:30488484-30488506 CCCACCACGCCCACTCGGGGTGC No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866110_1171866129 26 Left 1171866110 20:30488467-30488489 CCCAAACCCTCCGGGTGCCCACC No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data
1171866120_1171866129 5 Left 1171866120 20:30488488-30488510 CCACGCCCACTCGGGGTGCCGCC No data
Right 1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171866129 Original CRISPR GGTCCCAAAGGCGCACGCCC GGG Intergenic
No off target data available for this crispr