ID: 1171870212

View in Genome Browser
Species Human (GRCh38)
Location 20:30519233-30519255
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171870205_1171870212 25 Left 1171870205 20:30519185-30519207 CCTGGGTGGTGATATCAGCCATT No data
Right 1171870212 20:30519233-30519255 GTGTGACAGTAGCAAGTAGATGG No data
1171870209_1171870212 7 Left 1171870209 20:30519203-30519225 CCATTACAGGGGCCTCTTCTGCT No data
Right 1171870212 20:30519233-30519255 GTGTGACAGTAGCAAGTAGATGG No data
1171870211_1171870212 -5 Left 1171870211 20:30519215-30519237 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 1171870212 20:30519233-30519255 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171870212 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr