ID: 1171870694

View in Genome Browser
Species Human (GRCh38)
Location 20:30522174-30522196
Sequence GTGGGTTGCAAGGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171870694_1171870702 6 Left 1171870694 20:30522174-30522196 CCAGCAGCATCCTTGCAACCCAC No data
Right 1171870702 20:30522203-30522225 CGGAGATCCACAGATCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171870694 Original CRISPR GTGGGTTGCAAGGATGCTGC TGG (reversed) Intergenic
No off target data available for this crispr