ID: 1171879591

View in Genome Browser
Species Human (GRCh38)
Location 20:30608507-30608529
Sequence CTGAATCAGCAGGAGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171879588_1171879591 24 Left 1171879588 20:30608460-30608482 CCAGGGCATTGAAAATTGGCACA No data
Right 1171879591 20:30608507-30608529 CTGAATCAGCAGGAGAAAAGAGG No data
1171879589_1171879591 -9 Left 1171879589 20:30608493-30608515 CCTTAAGTCATTCTCTGAATCAG No data
Right 1171879591 20:30608507-30608529 CTGAATCAGCAGGAGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171879591 Original CRISPR CTGAATCAGCAGGAGAAAAG AGG Intergenic
No off target data available for this crispr