ID: 1171883258

View in Genome Browser
Species Human (GRCh38)
Location 20:30633139-30633161
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 22, 1: 24, 2: 58, 3: 108, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171883258_1171883266 17 Left 1171883258 20:30633139-30633161 CCCTCAGTATGGAAAAGCTACAG 0: 22
1: 24
2: 58
3: 108
4: 292
Right 1171883266 20:30633179-30633201 AGCCCATGACAGCAGCCATGGGG 0: 5
1: 77
2: 421
3: 758
4: 1474
1171883258_1171883265 16 Left 1171883258 20:30633139-30633161 CCCTCAGTATGGAAAAGCTACAG 0: 22
1: 24
2: 58
3: 108
4: 292
Right 1171883265 20:30633178-30633200 CAGCCCATGACAGCAGCCATGGG 0: 5
1: 59
2: 156
3: 316
4: 713
1171883258_1171883264 15 Left 1171883258 20:30633139-30633161 CCCTCAGTATGGAAAAGCTACAG 0: 22
1: 24
2: 58
3: 108
4: 292
Right 1171883264 20:30633177-30633199 CCAGCCCATGACAGCAGCCATGG 0: 5
1: 80
2: 135
3: 293
4: 633
1171883258_1171883267 18 Left 1171883258 20:30633139-30633161 CCCTCAGTATGGAAAAGCTACAG 0: 22
1: 24
2: 58
3: 108
4: 292
Right 1171883267 20:30633180-30633202 GCCCATGACAGCAGCCATGGGGG 0: 5
1: 59
2: 92
3: 563
4: 1033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171883258 Original CRISPR CTGTAGCTTTTCCATACTGA GGG (reversed) Intergenic
905985791 1:42280614-42280636 CTGCAGTTTTTCATTACTGAAGG - Intronic
907479473 1:54735027-54735049 GAGGAGCTCTTCCATACTGAAGG - Intronic
907703473 1:56812712-56812734 CTGTCCGTTTTCCATGCTGAGGG + Intronic
909060115 1:70869862-70869884 CTGTGGCTCTTCTACACTGAGGG + Intronic
910270228 1:85386591-85386613 CTGCAGCTTTTCCAAGCTGAGGG + Intronic
910908078 1:92203179-92203201 CTGCAGCTATTTCAAACTGAAGG + Intergenic
911007572 1:93242980-93243002 CTGTGGCTTTTCCAGGCTCATGG + Intronic
911686223 1:100780492-100780514 CTGTAGCTTTTCCAGGCACATGG + Intergenic
911983428 1:104594346-104594368 CTGCAGCTTTTCCATGCACATGG - Intergenic
912182743 1:107238030-107238052 CTGCAGCTTTTCCACACTCACGG - Intronic
913176307 1:116276213-116276235 CTGTTGCTTCTACATGCTGAGGG - Intergenic
913459046 1:119064001-119064023 CTGTGGCTTTTCCAGGCTCACGG - Intronic
918373082 1:183881299-183881321 GTGATGCTTTTCCATACTGAAGG - Intronic
918920165 1:190698629-190698651 CTGCAGCTTTTCCAGGCTCACGG - Intergenic
919143783 1:193607432-193607454 ATGTAGCTATTTCATGCTGAAGG + Intergenic
919409644 1:197227626-197227648 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
920691293 1:208148487-208148509 CTGTAGCTGTCCCATAATGGTGG + Intronic
921536108 1:216350739-216350761 CTGCAGTTTTTCCTTGCTGAGGG + Intronic
921751296 1:218796958-218796980 CTGAAGCTTTTTCAGAATGATGG - Intergenic
922520318 1:226244818-226244840 AGGTAGCTTGGCCATACTGACGG - Intronic
923097185 1:230784884-230784906 CTGTGGCTTTTCCAGGCTCAAGG - Intronic
923346391 1:233057417-233057439 CTGTAGTTTTACCACACTGCAGG + Intronic
1064169057 10:13013828-13013850 CTGTAGCTGTTCCAGATTGAAGG + Intronic
1065047499 10:21757454-21757476 CTGTAGCTTTTGCTGACTAAGGG + Intronic
1066441421 10:35443028-35443050 CTGTACCTTTTCCATGTTTAGGG - Intronic
1067783065 10:49223076-49223098 CTGCAGCTTTTCCAGGCTTAGGG + Intergenic
1069040850 10:63694124-63694146 CTGTGGCTTTTCCAGACACATGG - Intergenic
1070245901 10:74730951-74730973 TTGCAGCTTTTCCAGGCTGAGGG - Intergenic
1070292332 10:75126010-75126032 CTGTGCCTTTTACATACTGATGG + Intronic
1070341384 10:75501547-75501569 TGGTGGCTTTTCCATATTGAGGG + Intronic
1071994029 10:91129175-91129197 CTGTAGCTTTTTCATTTTTATGG + Intergenic
1072940580 10:99760204-99760226 CTGTGACTTTTCCAGGCTGAGGG + Intergenic
1073701785 10:105935310-105935332 CTGTGGCTTTTCCAGGCTAAGGG - Intergenic
1073811052 10:107152440-107152462 CTGTAGCTTTTCCAAATGCATGG - Intronic
1073880345 10:107973578-107973600 CTGTGGCTTTTCCAGGCTCACGG - Intergenic
1078872296 11:15359666-15359688 CTGTTGCTTTTAAATAGTGAAGG - Intergenic
1079028078 11:16964618-16964640 CTGGAGTTTTACCAAACTGAAGG - Intronic
1079181908 11:18201301-18201323 CTGCAGCTTTTCCAGACACACGG + Intronic
1080379777 11:31756309-31756331 CTGTAGGGCTTCCATTCTGAAGG - Intronic
1080506226 11:32916689-32916711 CTGTACCTTTTCCATGTTTAGGG - Intronic
1080739364 11:35049360-35049382 CTGTGGCTTTTCCAGGCTCACGG - Intergenic
1081080438 11:38733468-38733490 CTGCAGCTTTTCCAGACACATGG + Intergenic
1081319192 11:41669272-41669294 CTGTAGCATTTCAGTACTGATGG - Intergenic
1084838795 11:71828019-71828041 CTGCAGCTTTTCCAGGCTCAGGG - Intergenic
1085086537 11:73671646-73671668 CTGTGGCTTTTCTAAACTCAGGG + Intergenic
1086078345 11:82877895-82877917 CTGTGGCTTTTCCAGGCTCACGG - Intronic
1086564662 11:88212009-88212031 CTGTGTCTTTTCCAGGCTGAGGG + Intergenic
1086794597 11:91084315-91084337 CTGTGGCTTTTCCATGCACATGG - Intergenic
1087230849 11:95661104-95661126 AAGTAGCTTTGCCATTCTGAAGG + Intergenic
1087578827 11:100025543-100025565 CTGCAGCTTTTCCAGGCTCATGG - Intronic
1089546018 11:119226089-119226111 CTGTAGCTTTTGCAGATTGTTGG + Intronic
1090319595 11:125830884-125830906 CTGTGGCTTTTCCAGGCTCAAGG + Intergenic
1091587212 12:1823063-1823085 CTGTGACTCTTCCATGCTGAGGG + Intronic
1092399880 12:8166070-8166092 CTGCAGCTTTTCCAGGCTCAGGG + Intronic
1092687427 12:11066541-11066563 CTGTAACTTTCCCACAATGATGG + Intronic
1092987694 12:13862499-13862521 ATGTAGCTTGGCCACACTGAAGG - Intronic
1093324708 12:17759800-17759822 CTGTGGCTTTTCCAGACACACGG + Intergenic
1093347221 12:18053137-18053159 CTGTTGCTTTGCCAAATTGAGGG + Intergenic
1093577930 12:20755945-20755967 CTGTAGCTTTACCTGTCTGAAGG - Intergenic
1093915032 12:24792194-24792216 CTGAAGATTTTCCATACAGTTGG + Intergenic
1094767922 12:33619012-33619034 CTGTGGCTTTTCCAGACACATGG - Intergenic
1095728107 12:45474319-45474341 CTGTGGCTTTTCCAGGCTCAGGG - Intergenic
1096917234 12:55046490-55046512 CTGTACCTTTTGCCTACTGATGG + Intergenic
1097510239 12:60529819-60529841 CTGCAGCTGTTCCATTCTGAGGG - Intergenic
1098939491 12:76518422-76518444 CTGCAGCTTTTCCAGGCTCAGGG + Intronic
1098964474 12:76772393-76772415 GTGTAGAATGTCCATACTGAGGG - Intronic
1100113514 12:91273996-91274018 GTGTAGCATTCCCATTCTGAGGG - Intergenic
1101691541 12:107087118-107087140 CTGTCACTTTTCCAGGCTGAGGG - Intronic
1104172062 12:126291731-126291753 CTGCAGCTTTTCCAGGCTCATGG + Intergenic
1105256503 13:18746870-18746892 CTGTAGCTTTTCTGTACTGAGGG - Intergenic
1105256718 13:18748226-18748248 CTGTGGCTTTTCCACACTGAGGG + Intergenic
1105257647 13:18754886-18754908 CTGTAGCTTTTCCACACTAAGGG + Intergenic
1105258509 13:18761184-18761206 CTGTAGCTTTTCAACACTAACGG + Intergenic
1105258707 13:18762878-18762900 CTGTAGCTTTTCCATACTTGGGG - Intergenic
1105259154 13:18766139-18766161 CTATCACTTTTCCATACTGAGGG - Intergenic
1105259390 13:18767587-18767609 CTGTGGCTTTTCCACACTGAGGG + Intergenic
1105260716 13:18777273-18777295 CTGTAGCTTTTCCACGATGAGGG + Intergenic
1105261176 13:18780485-18780507 CTGTAGCTTTTCAACACTAACGG + Intergenic
1105261375 13:18782181-18782203 CTGTAGCTTTTCTATACTTGGGG - Intergenic
1105261832 13:18785458-18785480 CTATCACTTTTCCATACTGAGGG - Intergenic
1105263008 13:18793679-18793701 CTGCAGCTTTTCCACAATGAGGG + Intergenic
1105263717 13:18798759-18798781 CTGTAGCTTTTCCATACTGGGGG - Intergenic
1105264189 13:18802047-18802069 CTATCACTTTTCCATACTGAGGG - Intergenic
1105264426 13:18803489-18803511 CCATAGCTTTTCCACACTGAGGG + Intergenic
1105264654 13:18805157-18805179 CTGTAGCTTTTCCACACGGAGGG - Intergenic
1107504160 13:41014580-41014602 TTGTAGGTTCTCCATACTAATGG + Intronic
1108098585 13:46931154-46931176 CTGAAACTCTTCCACACTGATGG - Intergenic
1108155178 13:47577195-47577217 CTGCAGCTTTTCCACACAGAGGG + Intergenic
1108956622 13:56166582-56166604 CTGTGGCTTTTCCAGACACATGG + Intergenic
1109503380 13:63267536-63267558 ATGCAGCTTTTCCAAACTCAGGG + Intergenic
1109611426 13:64769968-64769990 CAATAGCTTTTCTATACTTACGG + Intergenic
1110901793 13:80833974-80833996 CTGCAGCTTTTCCAGGCTCATGG + Intergenic
1111078061 13:83264388-83264410 CTGCAGCTTTTCCATGCGCATGG - Intergenic
1111461622 13:88551727-88551749 CTGAAGCTTTTAGATACTAAGGG + Intergenic
1111803236 13:93005795-93005817 ATGCAGCTTTTCCAGGCTGAGGG + Intergenic
1112067915 13:95814239-95814261 CTACAGCTTTTCCACACTGAAGG - Intronic
1112450949 13:99509222-99509244 CTGTAGCTTTTCCAGGCACAGGG + Intronic
1112992007 13:105525424-105525446 CTTCAGCTTTTCCATTCTGCTGG + Intergenic
1113280569 13:108783103-108783125 CTGTGGCTTTTCCAGGCTCATGG - Intronic
1113341738 13:109432549-109432571 CTGTGGCTTTTCCAGACACATGG + Intergenic
1115691314 14:35846896-35846918 CTTTATCTTTCCCTTACTGAGGG + Intronic
1116383121 14:44296867-44296889 CTGTAGCTTTTCCACACTGTGGG + Intergenic
1116577474 14:46592877-46592899 CTGTAGAATTTACAGACTGAAGG - Intergenic
1120347434 14:83308534-83308556 CTGTAGCTCCCCCATACTCAAGG - Intergenic
1121215517 14:92244670-92244692 CTGTAGCTTTTCCAGGCTGAGGG + Intergenic
1123064663 14:105611428-105611450 CTGTGGCTTTTCCAGATTCAGGG - Intergenic
1123073966 14:105657069-105657091 CTGTGGCTTTTCCAGATTCAGGG - Intergenic
1123087967 14:105726652-105726674 CTGTGGCTTTTCCAGATTCAGGG - Intergenic
1123093925 14:105756025-105756047 CTGTGGCTTTTCCAGATTCAGGG - Intergenic
1202833797 14_GL000009v2_random:62905-62927 CTGTAGCTTTTCCACACGGAGGG + Intergenic
1202834022 14_GL000009v2_random:64579-64601 CCATAGCTTTTCCACAATGAGGG - Intergenic
1202834262 14_GL000009v2_random:65994-66016 CTATCACCTTTCCATACTGAGGG + Intergenic
1202834727 14_GL000009v2_random:69272-69294 CTGAAGCTTTTCCATACTGGGGG + Intergenic
1202834934 14_GL000009v2_random:70961-70983 CTGTAGCTTTTCAACACTAAGGG - Intergenic
1202835342 14_GL000009v2_random:74043-74065 CTGTAGCATTTCCATACTAAGGG - Intergenic
1123720914 15:23061377-23061399 CTTTGGCTTTTCCAGGCTGAGGG + Intergenic
1124401240 15:29349564-29349586 CTATAAGTTTTCCATACTGTAGG - Intronic
1125251832 15:37713687-37713709 CTGCAGCTTTTCCATGCGGAGGG - Intergenic
1125304176 15:38291345-38291367 CTGTGGCTTTTCCAGACACATGG + Intronic
1125407621 15:39369934-39369956 CTGCAGCTTTTCCAGACACATGG + Intergenic
1126800425 15:52293115-52293137 CTGTAGCTTTTCAAAAGAGATGG + Intronic
1126815093 15:52446635-52446657 CTGTGGCTTTTCTAGGCTGAAGG - Intronic
1126942783 15:53784582-53784604 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
1127126915 15:55820662-55820684 CTGAAGGTGTTCCCTACTGAAGG - Intergenic
1129620227 15:77137354-77137376 CTGTGGCTTTTCCACACACATGG - Intronic
1131700880 15:94934451-94934473 CTGTGGCTTTTCCATGCCAATGG + Intergenic
1138859937 16:60744045-60744067 CTGCAGCTTTTCCAGGCTCACGG + Intergenic
1141815581 16:86407479-86407501 CTGTAGCTTATCACTGCTGAGGG + Intergenic
1143455932 17:7067784-7067806 CTGTAGCTTTTCCAGGCACAGGG + Intergenic
1145407604 17:22619031-22619053 CTGTAGCTCTCAAATACTGATGG + Intergenic
1149025129 17:52018294-52018316 CTGTGGCTTTTTCAGACTGAGGG - Intronic
1151950310 17:77349927-77349949 CTGTAGGTTTTACACACTCATGG - Intronic
1152120722 17:78416711-78416733 CTGTAGCTCTTCCATTCTTTAGG + Intronic
1153138196 18:1941715-1941737 CTGCAGCTTTTCCAGGCTGAGGG - Intergenic
1154423968 18:14258072-14258094 CCATAGCTTTTCCACACTGAGGG - Intergenic
1154424209 18:14259514-14259536 CTATCACTTTTCCATACTGAGGG + Intergenic
1154424644 18:14262628-14262650 CTGTAGCTTTTCCGTACTTGTGG + Intergenic
1154424849 18:14264322-14264344 CTGTAGCTTTTCAACACTAACGG - Intergenic
1154425301 18:14267519-14267541 CTATAGCTTTTCCACAATGAAGG - Intergenic
1154425502 18:14268905-14268927 CTATAGCTTTTCCACACTAAGGG + Intergenic
1154426878 18:14278716-14278738 CTATCACTTTTCCATACTGAGGG + Intergenic
1154427326 18:14281977-14281999 CTGTAGCTTTTCCATATTGGGGG + Intergenic
1154427530 18:14283655-14283677 CTGTAGCTTTTCAACACTGAGGG - Intergenic
1154428031 18:14287104-14287126 CTGCAGCTTTTCCACAATGAGGG - Intergenic
1154428232 18:14288491-14288513 CTGTAGCTTTTCCACACTAAGGG + Intergenic
1154429610 18:14298250-14298272 CTATCACTTTTCCATACTGAGGG + Intergenic
1154430258 18:14303195-14303217 CTGTAGCTTTTCAACACTGAGGG - Intergenic
1154430744 18:14306616-14306638 CTGCAGCTTTTCCACAATGAGGG - Intergenic
1154431634 18:14313149-14313171 CTGTGGCTTGTCCACACTGAGGG - Intergenic
1154431879 18:14314596-14314618 CTATCACTTTTCCATACTGAGGG + Intergenic
1154432341 18:14317853-14317875 CTGTTGCTTTTCCATACATGGGG + Intergenic
1154432534 18:14319545-14319567 CTGTAGCTTTTCAACACTAAGGG - Intergenic
1154432997 18:14322758-14322780 CTATAGCTTTTCCACAATGAGGG - Intergenic
1154433197 18:14324146-14324168 CTGTAGCTTTTCCACACTAAGGG + Intergenic
1154434325 18:14332452-14332474 CTGTGGCTTTTCCACACTGAGGG - Intergenic
1154434538 18:14333808-14333830 CTGTAGATTTTCCATACTGAGGG + Intergenic
1155108128 18:22687641-22687663 CTGGAGCTTTTCCAGGCTCAGGG + Intergenic
1159136840 18:64346515-64346537 ATGAAGCTTTTCCTTACTCAGGG - Intergenic
1162217141 19:9145632-9145654 CTGTAGATTTTTCATTTTGAAGG - Intronic
1163068902 19:14821276-14821298 CTGTATCTATTCCATATTTATGG - Intronic
1164489383 19:28692700-28692722 CTGTGGCTTTTCCAGGCTCAGGG - Intergenic
1165974740 19:39665867-39665889 CTGAAGCTTTTCCAGGCTCATGG + Intergenic
1202637282 1_KI270706v1_random:53306-53328 CTGTAGCATTTCCATACTAAGGG + Intergenic
1202637769 1_KI270706v1_random:56731-56753 CTGTAGCTTTTCAACACTAAGGG + Intergenic
1202637975 1_KI270706v1_random:58421-58443 CTGAAGCTTTTCCATACTGGGGG - Intergenic
1202638420 1_KI270706v1_random:61698-61720 CTATCACTTTTCCATACTGAGGG - Intergenic
1202638659 1_KI270706v1_random:63113-63135 CCATAGCTTTTCCACACTGAGGG + Intergenic
1202638875 1_KI270706v1_random:64787-64809 CTGTAGCTTTTCCACACGGAGGG - Intergenic
925554463 2:5114560-5114582 CTGTAGCTTTTCCAGGCACAGGG - Intergenic
926611869 2:14955353-14955375 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
928267562 2:29824423-29824445 CTGTGGCTTTTCCAGGCTCATGG - Intronic
928731511 2:34237833-34237855 CTGTAGCTTTTCCAGGCAAACGG - Intergenic
929504582 2:42518600-42518622 ATGTAGCTATTCCACCCTGAAGG + Intronic
931800881 2:65756665-65756687 CTGTGGCTTTTCCAGGCTGAAGG + Intergenic
932842291 2:75094957-75094979 CTGTAGCTTCTCTATCCTAAAGG - Intronic
934491552 2:94764680-94764702 CTGTTGCTTTTCCATACTGAGGG - Intergenic
934491773 2:94766042-94766064 CTGTGGCTTTTCCACACTGAGGG + Intergenic
934491983 2:94767767-94767789 CTGTAGCTTTTCCATACTGAGGG - Intergenic
934492449 2:94770910-94770932 CTGTAGCTTTTCCATACTGAGGG - Intergenic
934492585 2:94771785-94771807 CTGTAGCTTTTCCACACTGAGGG - Intergenic
934492798 2:94773184-94773206 CTGTAGCTTATCCACAATGAGGG + Intergenic
934494112 2:94782630-94782652 CTGTAGCTTTTCCATACTGAGGG + Intergenic
934494336 2:94784311-94784333 CTGTAGCTTTTCCACACTGAGGG - Intergenic
934874138 2:97898797-97898819 CAGAAGCTTTTCAATACTCATGG - Intronic
935329913 2:101969380-101969402 CTGCAGCTTTTCCAGGCAGAGGG + Intergenic
936470177 2:112791710-112791732 CTGCAGCTTTTCCAGGCTCAGGG - Intergenic
936694318 2:114928580-114928602 CTGTGGCTTTTCCAGCCTGAGGG + Intronic
937327932 2:121003224-121003246 CTGCAGCTTTTCCAGGCTCAGGG - Intergenic
937803667 2:126111501-126111523 ATGTACATTTTCCATCCTGATGG + Intergenic
938165418 2:129021544-129021566 CTGTGGCTTTTCCAGGCTCACGG - Intergenic
938279762 2:130055635-130055657 CTGTAGCTTTTACCCACTGACGG + Intergenic
938279848 2:130056143-130056165 CGGTAGCTTTTCCATACTGAAGG - Intergenic
938280072 2:130057557-130057579 CTGTAGCTTTTCCACACTGAGGG + Intergenic
938330713 2:130446349-130446371 CTGTAGCTTTTACCCACTGACGG + Intergenic
938330800 2:130446858-130446880 CGGTAGCTTTTCCATACTGAAGG - Intergenic
938331029 2:130448272-130448294 CTGTAGCTTTTCCACACTGAGGG + Intergenic
938358919 2:130673231-130673253 CTGTAGCTTTTCCACACTGAGGG - Intergenic
938359145 2:130674645-130674667 CGGTAGCTTTTCCATACTGAAGG + Intergenic
938359231 2:130675154-130675176 CTGTAGCTTTTACCCACTGACGG - Intergenic
938435310 2:131279884-131279906 CTGTAGCTTTTCCACACTGAGGG - Intronic
938435546 2:131281294-131281316 CGGTAGCTTTTCCATACTGAAGG + Intronic
938435633 2:131281803-131281825 CTGTAGCTTTTACCCACTGACGG - Intronic
938472460 2:131577400-131577422 CTGTACCTTTTACTTAATGAAGG + Intergenic
938898912 2:135781516-135781538 CTAGGGCTTCTCCATACTGAGGG - Intronic
939014393 2:136885373-136885395 TTTTAGGATTTCCATACTGAGGG + Intronic
940825660 2:158409273-158409295 CTGTTGCTTTTCCAGGCTCATGG - Intronic
941967862 2:171317642-171317664 CTCTAGCTGTTCCTTACTTAAGG + Exonic
942880680 2:180857491-180857513 CTGTGGCTTTTCCACACACATGG + Intergenic
943271596 2:185812124-185812146 CTGAGGCTTTTCCACGCTGAGGG - Intronic
943297904 2:186161288-186161310 CTGTAGCTTTTCCAGGCACATGG - Intergenic
944011415 2:194979315-194979337 CTGTAGCTTTTCCAGGCACATGG + Intergenic
946186329 2:217982778-217982800 CTTTGGCTTTTGCATTCTGATGG - Intronic
1170318675 20:15069976-15069998 CTGTGGCTTTTCCAGGCTCAAGG - Intronic
1171883258 20:30633139-30633161 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1171883656 20:30636025-30636047 CTGTAGCTTTTCCACACCAAGGG - Intergenic
1171884343 20:30640823-30640845 CTGTAGCTTTTCAACACTAAGGG + Intergenic
1171885003 20:30645760-30645782 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1171885247 20:30647233-30647255 CCGTAGCTTTTCCCCACTGAGGG + Intergenic
1171885475 20:30648914-30648936 CTGTAGCTTTTCCACACGGAGGG - Intergenic
1173347511 20:42214476-42214498 CTGTAACTTTGCCATGCTGGGGG - Intronic
1175869811 20:62203439-62203461 GTGTAGCTTTACCCTACTCAGGG - Intronic
1176696035 21:9978770-9978792 CTGCAGCTTTTCCATGCACACGG - Intergenic
1176842500 21:13851898-13851920 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1176842711 21:13853266-13853288 CTGTGGCTTTTCCACACTGAGGG + Intergenic
1176844053 21:13862997-13863019 CTATAGGTTTTCCACAATGAGGG + Intergenic
1176844507 21:13866203-13866225 CTGTAGCTTTTCAACACTAAGGG + Intergenic
1176844693 21:13867898-13867920 CTGTAGCTTTTCGATACTGGGGG - Intergenic
1176845161 21:13871166-13871188 CTATCACTTTTCCATACTGAGGG - Intergenic
1176845401 21:13872613-13872635 CTGTGGCTTTTCCACACTGAGGG + Intergenic
1176846526 21:13880931-13880953 CTGTAGCTTTTCTACACTAAGGG - Intergenic
1176846732 21:13882321-13882343 CTGCAGCTTTTCCACAATGAGGG + Intergenic
1176847233 21:13885766-13885788 CTGTAGCTTTTCAACACTAAGGG + Intergenic
1176847437 21:13887462-13887484 CTGTAGCTTTTCCGTACATGGGG - Intergenic
1176848130 21:13892170-13892192 CTTTGACTTTTCCACACTGAGGG + Intergenic
1176849263 21:13900482-13900504 CTATCACTTTTCCATACTGAGGG - Intergenic
1176849500 21:13901931-13901953 CCATAGATTTTCCACACTGAGGG + Intergenic
1176849733 21:13903605-13903627 CTGTAGATTTTCCACACGGAGGG - Intergenic
1177328791 21:19629273-19629295 CTGTGGCTTTTCCAGGCTCAAGG - Intergenic
1177554561 21:22672533-22672555 CTGTGGCTTTTCCAGGCTCATGG - Intergenic
1177676571 21:24308639-24308661 CTGCTGCTTTTCCAGGCTGATGG + Intergenic
1177780379 21:25615904-25615926 ATCTAACTGTTCCATACTGATGG + Intergenic
1178735661 21:35147588-35147610 CTGGAACTTTTCATTACTGAGGG + Intronic
1179428596 21:41303469-41303491 ATGTAGTTTTTACAAACTGAAGG - Intergenic
1179432673 21:41334800-41334822 CTGTGGCTTTTCCATGCTGAGGG - Intronic
1180363084 22:11917102-11917124 CTGTAGCTTTTCCACACGGAGGG + Intergenic
1180363308 22:11918775-11918797 CCATAGCTTTTCCACACTGAGGG - Intergenic
1180363547 22:11920190-11920212 CTATCACTTTTCCATACTGAGGG + Intergenic
1181802171 22:25354812-25354834 CTGTATCTTTGCCATTCTGCAGG - Exonic
1184713215 22:46265327-46265349 CTGCAGCTTTTCTAGACTCATGG + Intergenic
1185362754 22:50418818-50418840 CTGTTTCTTCTCCACACTGAGGG + Intronic
949398735 3:3643295-3643317 CTGTGCATTTTCCACACTGATGG + Intergenic
949665361 3:6332234-6332256 CTGTAGCTTTTCCAGGCACATGG - Intergenic
951518906 3:23592704-23592726 CTCTAGCTTTTACATTTTGAGGG - Intergenic
952481774 3:33769204-33769226 TTGTAGATTTTCCAAACAGAAGG - Intergenic
954076802 3:48187789-48187811 CTGCAGCTGGTCCATAGTGACGG + Exonic
955155823 3:56415637-56415659 CTGTAGCATTTCTATAGGGATGG + Intronic
956149385 3:66225041-66225063 CTGTAGCTTTTCCAGGCACAGGG + Intronic
957728895 3:84106395-84106417 CAGTATCTTTTCCATGATGATGG + Intergenic
957870278 3:86082946-86082968 CTGTGGCTTTTCCAGGCTCACGG + Intergenic
959262860 3:104103282-104103304 CTGTTTCTTCTCCAGACTGAAGG + Intergenic
959285074 3:104398108-104398130 CTGTTTCTTTTCCAGACTTATGG - Intergenic
959433439 3:106283991-106284013 CTGTAGCTTTCCCAGGCTGCAGG - Intergenic
959756465 3:109905719-109905741 CTGCAGCTTTTCCAGGCTCATGG + Intergenic
959862305 3:111229917-111229939 CTGCAGCTTTTCCAAGCTCAGGG - Intronic
960675051 3:120185503-120185525 CTGCAGTTTTTACATACTGAGGG - Intronic
961315043 3:126028699-126028721 CTGCAGATTTTCCAGGCTGATGG - Intronic
961525422 3:127493920-127493942 CTGTGGCTTTTCCATGCTCAGGG + Intergenic
961701942 3:128751281-128751303 CTGTAGCTTTTCCAAGTGGATGG - Intronic
962045818 3:131758180-131758202 CTGCAGCTTTTCCAGACAGATGG - Intronic
963271997 3:143294367-143294389 CTTTAGCTTTGCCCTACTAAAGG - Intronic
963710804 3:148745519-148745541 ATGTAGCTTTTGCATTCTGTTGG - Intergenic
963716727 3:148811920-148811942 CTGTGGCTTTTCCAGGCTCACGG - Intronic
963824110 3:149932754-149932776 CTGTGCCTTTTCAATGCTGAGGG + Intronic
965198889 3:165631563-165631585 CTGCAGCTTTTCCAGGCTCACGG - Intergenic
965397230 3:168174263-168174285 CTGTAGGTTTTCCAGACACATGG + Intergenic
967048047 3:185755525-185755547 CTGTAGCTTTTTCTTGCTGAGGG - Intronic
968350502 3:198048443-198048465 CTGTAGCTTTTCCATACTGAGGG - Intergenic
968350737 3:198049839-198049861 CTGTAGCTTTTCCCCACTGATGG + Intergenic
969780216 4:9395503-9395525 CTGCAGCTTTTCCAGGCTCAGGG - Intergenic
970706974 4:18816116-18816138 CTGTAGCTTTTCCAGATTGAGGG - Intergenic
970707596 4:18823229-18823251 TTGTGGCTTTTCCATGCTAAGGG - Intergenic
970918561 4:21365734-21365756 CTGTATATTTTCTATTCTGAAGG - Intronic
971556123 4:28014480-28014502 CAGCACCTTTTCCATACTTATGG + Intergenic
973367096 4:49216602-49216624 CTGTAGCTTTTCCACATTAAGGG + Intergenic
973367527 4:49219683-49219705 CTATAGCTTTTCCACAATCAGGG + Intergenic
973368003 4:49223096-49223118 CTGTAGCTTTTCAACAGTAAGGG + Intergenic
973368198 4:49224782-49224804 CTGAAGCTTTTCCATACTGGGGG - Intergenic
973368656 4:49228041-49228063 CTATCACTTTTCCATACTGAGGG - Intergenic
973369120 4:49231167-49231189 CTGTAGCTTTTCCACACGGAGGG - Intergenic
973391920 4:49564249-49564271 CTGTAGCTTTTCCACACGGAGGG + Intergenic
973392393 4:49567384-49567406 CTATCACTTTTCCATACTGAGGG + Intergenic
973392849 4:49570643-49570665 CTGAAGCTTTTCCATACTGGGGG + Intergenic
973393046 4:49572330-49572352 CTGTAGCTTTTCAACACTAAGGG - Intergenic
973393520 4:49575759-49575781 CTGTAGCATTTCCATACTAAGGG - Intergenic
975954948 4:79826155-79826177 CTGTAGCACTTCCTTATTGAGGG + Intergenic
976057137 4:81081700-81081722 CTGCAGCTTTTCCAGACACATGG - Intergenic
976453565 4:85219690-85219712 CTGCAGCTTTTCCACACTGAGGG - Intergenic
976672887 4:87673751-87673773 CTGTAGCTTTTCCAGCCACATGG + Intergenic
977380694 4:96270094-96270116 CTGTAGCTTTGCCAGAATGTTGG - Intergenic
977504819 4:97888282-97888304 CAATAGCTTTTCCAGGCTGAGGG - Intronic
977512073 4:97973996-97974018 CTGTAGCTTTTCCAGGCACATGG - Intronic
977528554 4:98173371-98173393 CAGTATCTTCTACATACTGAGGG + Intergenic
978134445 4:105240250-105240272 CTGTGACTTTTACAAACTGAAGG - Intronic
978202175 4:106035007-106035029 CTGTAACTTTTCCATGCTTCAGG - Intergenic
978693029 4:111538922-111538944 CTGTAGATTTTGAATATTGAAGG - Intergenic
978921070 4:114183497-114183519 CTGTGGCTTTTCCAGGCTCATGG - Intergenic
979182892 4:117753457-117753479 CTGTGGCTTTTCCATGCACATGG - Intergenic
979495455 4:121378225-121378247 CTTTAGCTTCTAAATACTGAAGG - Intronic
981335402 4:143563301-143563323 CTGTGGCTTTTCAAGGCTGAAGG - Intergenic
981866144 4:149421654-149421676 CTGTAGCATTTGCATACTGTGGG - Intergenic
981964161 4:150580748-150580770 CTGTAGCCTTTCCATACTTTTGG - Intronic
982058918 4:151583269-151583291 CTGTTTCTTTGCCATTCTGAAGG + Intronic
982609138 4:157551493-157551515 CTGTAGCTTTTCCAGGCACATGG - Intergenic
983006790 4:162493651-162493673 CTGTGGCTTTTCCAGGCAGATGG - Intergenic
983240376 4:165225227-165225249 CTGAAGCTTTTCCATAAGGTTGG + Intronic
983785954 4:171729522-171729544 CTGTGGCTTTTCCAGACACACGG - Intergenic
984353177 4:178621828-178621850 CTGTGGCTTTTCCAGGCTCAAGG + Intergenic
985371769 4:189292600-189292622 CTGTGGCTTTTCCAGGCTCATGG - Intergenic
1202764601 4_GL000008v2_random:139163-139185 CTGTAGCATTTCCATACTAAGGG + Intergenic
1202765090 4_GL000008v2_random:142588-142610 CTGTAGCTTTTCAACACTAAGGG + Intergenic
1202765298 4_GL000008v2_random:144278-144300 CTGAAGCTTTTCCATACTGGGGG - Intergenic
1202765754 4_GL000008v2_random:147556-147578 CTATCACTTTTCCATACTGAGGG - Intergenic
1202765996 4_GL000008v2_random:148972-148994 CCATAGCTTTTCCACACTGAGGG + Intergenic
1202766225 4_GL000008v2_random:150646-150668 CTGTAGCTTTTCCACACGGAGGG - Intergenic
986565233 5:9106882-9106904 CAGTATCTTTTCCATTGTGAAGG + Intronic
986924559 5:12731261-12731283 CTGCAGCTTTTCCAGGCTCAGGG + Intergenic
988606728 5:32684892-32684914 CTGTGGCTTTTCCAGGCTGAAGG - Intergenic
991054165 5:62304705-62304727 CTGTAGCTTGAACATATTGAAGG - Intergenic
992086214 5:73280684-73280706 CTGTAGCTCTTCTGGACTGAAGG - Intergenic
992666238 5:79012407-79012429 CTGCAGCTTTTGCAGGCTGAGGG + Intronic
993042828 5:82835227-82835249 CTTTGGCTTTTCCAGACTGAAGG + Intergenic
993146175 5:84096261-84096283 CTGTGGCTTTTCCAGACACACGG - Intronic
993890189 5:93463570-93463592 CTGTAGCTTTTCCAGGCACATGG - Intergenic
994095608 5:95844697-95844719 CTGTTGCTTTTCCACTCTGCTGG - Intergenic
994507936 5:100665332-100665354 CTGCAGATTTTCTATGCTGAGGG + Intergenic
994542758 5:101121256-101121278 CTGTGGCTTTTCCATGCACACGG + Intergenic
994905707 5:105839151-105839173 CTGCAGCTTTTCCAGGCTCAGGG + Intergenic
995333788 5:110976049-110976071 CTGCAGCTTTTCCATGCACATGG + Intergenic
996612309 5:125396853-125396875 TTATAGTTTTTCAATACTGATGG + Intergenic
998938243 5:147253802-147253824 CTTTTGCTTATCCATACTGGAGG + Intronic
1000830255 5:166093559-166093581 CTGCCACTTTTTCATACTGAGGG + Intergenic
1000882531 5:166714585-166714607 CTGTGGCTTTTCCAGGCCGAGGG + Intergenic
1002599896 5:180348109-180348131 CTGTTGCTTCTCCGAACTGAAGG + Intronic
1003226853 6:4213946-4213968 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
1003821398 6:9901509-9901531 CTGTTTCTTTTCCATTCTGATGG - Intronic
1007299298 6:40854581-40854603 CTGTTGCCTCTCCATACTGGTGG - Intergenic
1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG + Exonic
1009268750 6:61591328-61591350 ATATAGCTTCTCCATACTTATGG - Intergenic
1009316056 6:62222938-62222960 CTGTGGCTTTTCCAGACACACGG + Intronic
1009888401 6:69652325-69652347 CTGAACCATTCCCATACTGACGG - Intergenic
1010330968 6:74623670-74623692 CTGTGGCTTTTCCAAACTTATGG - Intergenic
1010590672 6:77708137-77708159 CTGCAGCTTTTCCAGGCTCAGGG - Intronic
1011821253 6:91256065-91256087 CTGTGGCTTTTCCATATGAATGG - Intergenic
1014058919 6:117048690-117048712 CTATATCTTTTGTATACTGACGG + Intergenic
1014075573 6:117230816-117230838 CTGAAGCTTTTCCAGGCTGAGGG + Intergenic
1014374738 6:120658981-120659003 CTGTAGCTTTTCCAGGCACATGG + Intergenic
1014509923 6:122308208-122308230 CTGTGGCTTTTCCAGGCTCAAGG - Intergenic
1015252622 6:131142756-131142778 CTGCAGCTTTTCCAAGCTCAGGG - Intronic
1015667754 6:135650709-135650731 CTGTGGCTTTTCCAGACACATGG - Intergenic
1016040877 6:139430994-139431016 CTGTATATTTTCCATGTTGAAGG + Intergenic
1016296025 6:142574384-142574406 CTGTAGCTTTTCCAAGCACACGG - Intergenic
1019050586 6:169180058-169180080 CTGTGGCTTTTCCAGGCTCACGG + Intergenic
1019098616 6:169609170-169609192 CTGCAGCTTTTCCGTGCTCATGG + Intronic
1020668196 7:11073554-11073576 CTGTGGCTTTTCCAGGCTCAGGG + Intronic
1022935524 7:35171553-35171575 CAGTTGCTTTTCATTACTGAAGG - Intergenic
1023386323 7:39661714-39661736 CTGTGGCTTTTCCAGACTCATGG + Intronic
1024527273 7:50359520-50359542 CTGTGACTTTTCCATGCAGAAGG - Intronic
1024645593 7:51368118-51368140 CTGCGGCTTTTCCAGGCTGAGGG + Intergenic
1027877231 7:83786739-83786761 TTGTATATTTTCCATACTAAGGG - Intergenic
1029938506 7:104454172-104454194 CTCCACCTTTTTCATACTGAAGG + Intronic
1029939421 7:104464319-104464341 CTGTGGCTTTTCCAGGCTCATGG + Intronic
1029948260 7:104556118-104556140 CTGTGGCTTTTCCAAGCTCATGG + Intronic
1030144639 7:106341049-106341071 CTGCAGCTTTTCCAGGCTCATGG + Intergenic
1030173123 7:106624891-106624913 CACTGTCTTTTCCATACTGAGGG + Intergenic
1031208452 7:118792416-118792438 CTGTGGCTCTTCTAGACTGAGGG + Intergenic
1031238721 7:119211161-119211183 CTGCAGCTTTTCCCGACTCATGG - Intergenic
1033063416 7:138129290-138129312 CTGAAGCTTTTCCAGGCTCAGGG + Intergenic
1033104920 7:138512251-138512273 CTGTGACTTTTCCAGACTAAAGG + Intronic
1035864683 8:3069666-3069688 CTGTGGCTTTTTCATGCTGAGGG + Intronic
1036277640 8:7369483-7369505 CTGCAGCTTTTCCAGGCTCAGGG - Intronic
1036282071 8:7408847-7408869 CCGTGGCTCTTCCATGCTGAGGG - Intergenic
1036339398 8:7902724-7902746 CCGTGGCTCTTCCATGCTGAGGG + Intergenic
1039259946 8:35760641-35760663 CAGAAGCTTTTCCAGAGTGAAGG - Intronic
1040102308 8:43516543-43516565 CTGTAGCTTTTCCAGACTGAGGG + Intergenic
1040102513 8:43518231-43518253 CTGTAGCTTTTCCCCTCTAAGGG - Intergenic
1040102728 8:43519630-43519652 CTGTAGCTTTTTCACATTGAGGG + Intergenic
1040103083 8:43522133-43522155 CTGTAGCTTCCTCACACTGAGGG + Intergenic
1040103395 8:43524655-43524677 CTGTAGCTTTCCCACACTTAGGG - Intergenic
1040103649 8:43526521-43526543 CTGTAAGTTTTTCACACTGAGGG + Intergenic
1040104182 8:43531013-43531035 CAGTGGCTTTTCCACACTCAGGG - Intergenic
1041386710 8:57312158-57312180 CTGTGGCTTTTCCACGCTCACGG - Intergenic
1041927599 8:63252481-63252503 CTGTGGCTTTTGCAGGCTGATGG - Intergenic
1042528966 8:69795616-69795638 CTGTGGCTTTTCCAGGCTAAGGG + Intronic
1044273677 8:90275557-90275579 CTGCAGCTTTTCCAGGCTCATGG - Intergenic
1046935389 8:119880607-119880629 AAGTAGCTTTTCCATTCTGTTGG + Intronic
1047042194 8:121008357-121008379 CTGCAGCTTCTCCATCCTGAAGG + Intergenic
1047245889 8:123144142-123144164 CTGTAGCTTTTCCAGAATTTCGG + Intronic
1048130706 8:131693919-131693941 CTGTAGCTTTTATACACTGAGGG + Intergenic
1048783014 8:138022136-138022158 CTGTGGCTTTTCCAGGCTCACGG - Intergenic
1048950796 8:139495364-139495386 CTGTTGGTTTTCCAGGCTGAGGG - Intergenic
1050148116 9:2591707-2591729 CTGAAGCCTTTCCATGCTGAGGG + Intergenic
1050648950 9:7754618-7754640 CTGTATCTTTGTAATACTGATGG - Intergenic
1051887397 9:21907937-21907959 CTATAGTTTTTCTATACTAAAGG - Intronic
1051935523 9:22438844-22438866 CTGTATTTTTTCCTTGCTGAGGG - Intergenic
1052057530 9:23921573-23921595 CTGTATTTTTTCCTTGCTGAGGG + Intergenic
1052193461 9:25684089-25684111 CTGCAGGTTTTCCACACTGATGG - Intergenic
1052877608 9:33578966-33578988 CTGTAGCTTTTCCACAGTGGGGG + Intergenic
1052877815 9:33580538-33580560 CTGTAGCTTTCCCACATTGAGGG - Intergenic
1052878475 9:33585036-33585058 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1052879338 9:33591214-33591236 CTGTAGCTTTTTCATACTGAGGG + Intergenic
1052879782 9:33594313-33594335 CCATAGCTTTTTCACACTGAGGG + Intergenic
1052880002 9:33595991-33596013 CTATAGCTTTTCCTGACTGATGG - Intergenic
1052880231 9:33597351-33597373 GTATAGCTTTTCCATACTGAGGG + Intergenic
1053495969 9:38548229-38548251 CTACAGCTTTTCCTGACTGATGG + Intronic
1053496639 9:38553003-38553025 CTGTAGCTTTTCCATACTGAGGG - Intronic
1053496852 9:38554404-38554426 CAGTAGCTTTTCAACACTAAGGG + Intronic
1053497506 9:38559173-38559195 CTGTAGCTTTTCCATACTGAGGG - Intronic
1053498168 9:38563667-38563689 CTGTAGCTTTCCCACATTGAGGG + Intronic
1053498380 9:38565242-38565264 CTGTAGCTTTTCCACAGTGGGGG - Intronic
1053662786 9:40296057-40296079 CTGTAGCTTTTCCACACTGAGGG + Intronic
1053662958 9:40297374-40297396 CTGTAGCTTTTCCATACTGAGGG - Intronic
1053663199 9:40298820-40298842 CTATCACTTTTCCAAACTGAGGG + Intronic
1053664170 9:40305891-40305913 CTGTAGCTTTTCCTCACTGAGGG + Intronic
1053664393 9:40307439-40307461 TCGTAGCTTTTCCATACTGAGGG - Intronic
1053664654 9:40308907-40308929 CTATGGCTTTTCCATACTGAGGG + Intronic
1053665137 9:40312096-40312118 CTGTAGCTTTTCCTCACTGAGGG + Intronic
1053665358 9:40313806-40313828 CTGTGGCTTTTCCACACTAAGGG - Intronic
1053666230 9:40319811-40319833 CTGTGGCTTTCCCACACTGAGGG - Intronic
1053666448 9:40321188-40321210 CTGTAGCTTTTCCATACTGAGGG + Intronic
1053913232 9:42926232-42926254 CTGTAGCTCATCCACACTGAGGG + Intergenic
1053913465 9:42927907-42927929 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1053914193 9:42932689-42932711 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1053914716 9:42937143-42937165 CTGTAGCTTTTCCTCACTGAGGG + Intergenic
1053914946 9:42938853-42938875 CTGTGGCTTTTCCACACTAAGGG - Intergenic
1053915813 9:42944858-42944880 CTGTGGCTTTTCCACACTGAGGG - Intergenic
1053916034 9:42946234-42946256 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1054374915 9:64442281-64442303 CTGTAGCTTTTCCACACTGAGGG + Intergenic
1054375085 9:64443598-64443620 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1054375320 9:64445044-64445066 CTATCGCTTTTCCAAACTGAGGG + Intergenic
1054375803 9:64448380-64448402 GTGTAGCTTTTCCATACTGAGGG + Intergenic
1054376297 9:64452126-64452148 CTGTAGCTTTTCCTCACTGAGGG + Intergenic
1054376509 9:64453836-64453858 CTGTGGCTTTTCCACACTAAGGG - Intergenic
1054377383 9:64459839-64459861 CTGTGGCTTTCCCACACTGAGGG - Intergenic
1054377600 9:64461216-64461238 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1054518161 9:66055095-66055117 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1054518379 9:66056472-66056494 CTGTGGCTTTCCCACACTGAGGG + Intergenic
1054519257 9:66062478-66062500 CTGTGGCTTTTCCACACTAAGGG + Intergenic
1054519480 9:66064188-66064210 CTGTAGCTTTTCCTCACTGAGGG - Intergenic
1054519962 9:66067377-66067399 CTATGGCTTTTCCATACTGAGGG - Intergenic
1054520221 9:66068846-66068868 TCGTAGCTTTTCCATACTGAGGG + Intergenic
1054520446 9:66070394-66070416 CTGTAGCTTTTCCTCACTGAGGG - Intergenic
1054520936 9:66074138-66074160 GTGTAGCTTTTCCATACTGAGGG - Intergenic
1054521415 9:66077465-66077487 CTATCACTTTTCCAAACTGAGGG - Intergenic
1054521657 9:66078910-66078932 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1054521827 9:66080227-66080249 CTGTAGCTTTTCCACACTGAGGG - Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055174308 9:73298963-73298985 CTGGAGCTTTTCCAGGCTCATGG + Intergenic
1056510864 9:87304306-87304328 CTGTAGGTTTTCCATTCTCGTGG - Intergenic
1056585854 9:87926679-87926701 CTGTAGCCTTTCCATACTGAGGG - Intergenic
1056586076 9:87928040-87928062 CTGTAGTTTTTCCCGACTGATGG + Intergenic
1056586313 9:87929728-87929750 CTGTAGCTTTTCCATGCAGAGGG - Intergenic
1056610569 9:88123215-88123237 CTGTAGCTTTTCCATGCAGAGGG + Intergenic
1056610806 9:88124903-88124925 CTGTAGTTTTTCCCGACTGATGG - Intergenic
1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG + Intergenic
1057161125 9:92889147-92889169 CTGTACCTTTTCCATACTGAGGG - Intergenic
1057161350 9:92890545-92890567 CTGTAGCTTTTCCACAGAGAGGG + Intergenic
1057161547 9:92892151-92892173 CTGTAGCTTTTCCACACTGAGGG - Intergenic
1057675674 9:97134382-97134404 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1057675896 9:97135747-97135769 ATGTAGCTTTTCACAACTGATGG + Intergenic
1057676122 9:97137454-97137476 CCATAGCTTTTTCACACTGAGGG - Intergenic
1057676555 9:97140564-97140586 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1057676762 9:97141962-97141984 CAGTAGCTTTTCAACACTAAGGG + Intergenic
1057676980 9:97143655-97143677 CTGTAGATTTTCCCTACTGAGGG - Intergenic
1057677415 9:97146760-97146782 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1057677639 9:97148163-97148185 CTGTATCTTTCCCACACTGAGGG + Intergenic
1057677842 9:97149729-97149751 CTGTAGCTTTTCCACAGTGAGGG - Intergenic
1057823186 9:98350010-98350032 CTTTAGGTTTTCCATATTGTTGG + Intronic
1203545350 Un_KI270743v1:124050-124072 CTGTAGCATTTCCATACTAAGGG + Intergenic
1203545838 Un_KI270743v1:127477-127499 CTGTAGCTTTTCAACACTAAGGG + Intergenic
1203546047 Un_KI270743v1:129167-129189 CTGAAGCTTTTCCATACTGGGGG - Intergenic
1203546504 Un_KI270743v1:132446-132468 CTATCACTTTTCCATACTGAGGG - Intergenic
1203546747 Un_KI270743v1:133861-133883 CCATAGCTTTTCCACGCTGAGGG + Intergenic
1203546974 Un_KI270743v1:135535-135557 CTGTAGCTTTTCCACACGGAGGG - Intergenic
1190269623 X:48852642-48852664 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
1191802180 X:65093421-65093443 CTGTAGCTTTTCCAGGCACAAGG - Intergenic
1192937018 X:75870901-75870923 CTGTAGCTTTTCCAGATGCAGGG - Intergenic
1193224972 X:78971858-78971880 CTGCAACTTTTCCATGCTGAGGG + Intergenic
1193273380 X:79555098-79555120 CTGCAGCTTTTCCAGGCTCATGG - Intergenic
1193911233 X:87309295-87309317 CTGTAGCTTTTCCAGGCTCATGG + Intergenic
1194373959 X:93109942-93109964 CTGTGGCTTTTCCAAGCTCAGGG + Intergenic
1194893317 X:99406991-99407013 CTGCAGCTTTTCCAGGCTCATGG - Intergenic
1195035144 X:100965477-100965499 CTGTAGCTTTTTCAGGCTCAAGG - Intergenic
1195041548 X:101019439-101019461 CTGAAGCTTTCCCTTACTGCTGG - Intronic
1195428549 X:104762464-104762486 CTGTGGCTTTTCCAGACCTACGG + Intronic
1197347666 X:125344517-125344539 CTGTGGGTTTTCCAGGCTGAGGG + Intergenic
1197856549 X:130919356-130919378 CTGCAGCTTTTCCAGGCTCACGG + Intergenic
1197975713 X:132163682-132163704 CTGCAGCTTTTCCAGACACATGG - Intergenic
1198456416 X:136822182-136822204 CTGAAGCTTTTCAATAATGCTGG - Intergenic
1199243513 X:145575516-145575538 CTACAGCTTTTCCAGACTGAGGG - Intergenic
1199421601 X:147650647-147650669 CTGTGGCTTTTCCATGCACAGGG - Intergenic
1199585582 X:149412803-149412825 CTATAGCTTTTCCATGCTGAGGG - Intergenic
1199931791 X:152530705-152530727 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
1200681987 Y:6224013-6224035 CTGTGGCTTTTCCAAGCTCAGGG + Intergenic
1202140219 Y:21713703-21713725 TTGGAACTTTTTCATACTGATGG + Intergenic