ID: 1171892016

View in Genome Browser
Species Human (GRCh38)
Location 20:30725278-30725300
Sequence CAACCACCATGGCCCCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171892016_1171892025 10 Left 1171892016 20:30725278-30725300 CCTCTCAGGGGCCATGGTGGTTG No data
Right 1171892025 20:30725311-30725333 GGAAACTGGGATGGGGTGAACGG No data
1171892016_1171892021 1 Left 1171892016 20:30725278-30725300 CCTCTCAGGGGCCATGGTGGTTG No data
Right 1171892021 20:30725302-30725324 GTTCTCCGTGGAAACTGGGATGG No data
1171892016_1171892022 2 Left 1171892016 20:30725278-30725300 CCTCTCAGGGGCCATGGTGGTTG No data
Right 1171892022 20:30725303-30725325 TTCTCCGTGGAAACTGGGATGGG No data
1171892016_1171892019 -4 Left 1171892016 20:30725278-30725300 CCTCTCAGGGGCCATGGTGGTTG No data
Right 1171892019 20:30725297-30725319 GTTGAGTTCTCCGTGGAAACTGG No data
1171892016_1171892020 -3 Left 1171892016 20:30725278-30725300 CCTCTCAGGGGCCATGGTGGTTG No data
Right 1171892020 20:30725298-30725320 TTGAGTTCTCCGTGGAAACTGGG No data
1171892016_1171892023 3 Left 1171892016 20:30725278-30725300 CCTCTCAGGGGCCATGGTGGTTG No data
Right 1171892023 20:30725304-30725326 TCTCCGTGGAAACTGGGATGGGG No data
1171892016_1171892026 28 Left 1171892016 20:30725278-30725300 CCTCTCAGGGGCCATGGTGGTTG No data
Right 1171892026 20:30725329-30725351 AACGGCCAGTTCCCGTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171892016 Original CRISPR CAACCACCATGGCCCCTGAG AGG (reversed) Intergenic
No off target data available for this crispr