ID: 1171892505

View in Genome Browser
Species Human (GRCh38)
Location 20:30728840-30728862
Sequence TGGCCAGAAGCTCCAGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171892505_1171892511 15 Left 1171892505 20:30728840-30728862 CCGCAGGCTGGAGCTTCTGGCCA No data
Right 1171892511 20:30728878-30728900 CCAATGAGCCTCCGCTTGCCTGG No data
1171892505_1171892512 16 Left 1171892505 20:30728840-30728862 CCGCAGGCTGGAGCTTCTGGCCA No data
Right 1171892512 20:30728879-30728901 CAATGAGCCTCCGCTTGCCTGGG No data
1171892505_1171892515 26 Left 1171892505 20:30728840-30728862 CCGCAGGCTGGAGCTTCTGGCCA No data
Right 1171892515 20:30728889-30728911 CCGCTTGCCTGGGAACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171892505 Original CRISPR TGGCCAGAAGCTCCAGCCTG CGG (reversed) Intergenic
No off target data available for this crispr