ID: 1171896873

View in Genome Browser
Species Human (GRCh38)
Location 20:30816010-30816032
Sequence TCCGCTGCTGCAGCACCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171896873_1171896879 8 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896879 20:30816041-30816063 ACGAGGTCCTGGGCTTCGGCTGG No data
1171896873_1171896888 27 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896888 20:30816060-30816082 CTGGGGCGCGGGGGTGGTCAAGG No data
1171896873_1171896889 28 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896889 20:30816061-30816083 TGGGGCGCGGGGGTGGTCAAGGG No data
1171896873_1171896878 4 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896878 20:30816037-30816059 CAGGACGAGGTCCTGGGCTTCGG No data
1171896873_1171896875 -9 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896875 20:30816024-30816046 AGCAGCGGATCTTCAGGACGAGG No data
1171896873_1171896884 16 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896884 20:30816049-30816071 CTGGGCTTCGGCTGGGGCGCGGG No data
1171896873_1171896891 30 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896891 20:30816063-30816085 GGGCGCGGGGGTGGTCAAGGGGG No data
1171896873_1171896886 18 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896886 20:30816051-30816073 GGGCTTCGGCTGGGGCGCGGGGG No data
1171896873_1171896877 -2 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896877 20:30816031-30816053 GATCTTCAGGACGAGGTCCTGGG No data
1171896873_1171896887 21 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896887 20:30816054-30816076 CTTCGGCTGGGGCGCGGGGGTGG No data
1171896873_1171896881 10 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896881 20:30816043-30816065 GAGGTCCTGGGCTTCGGCTGGGG No data
1171896873_1171896880 9 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896880 20:30816042-30816064 CGAGGTCCTGGGCTTCGGCTGGG No data
1171896873_1171896876 -3 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896876 20:30816030-30816052 GGATCTTCAGGACGAGGTCCTGG No data
1171896873_1171896890 29 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896890 20:30816062-30816084 GGGGCGCGGGGGTGGTCAAGGGG No data
1171896873_1171896883 15 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896883 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
1171896873_1171896885 17 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896885 20:30816050-30816072 TGGGCTTCGGCTGGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171896873 Original CRISPR TCCGCTGCTGCAGCACCGAC AGG (reversed) Intergenic
No off target data available for this crispr