ID: 1171896881

View in Genome Browser
Species Human (GRCh38)
Location 20:30816043-30816065
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171896873_1171896881 10 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896881 20:30816043-30816065 GAGGTCCTGGGCTTCGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171896881 Original CRISPR GAGGTCCTGGGCTTCGGCTG GGG Intergenic
No off target data available for this crispr