ID: 1171896882

View in Genome Browser
Species Human (GRCh38)
Location 20:30816048-30816070
Sequence CCGCGCCCCAGCCGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171896882_1171896898 14 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896898 20:30816085-30816107 GAGCAGAGGCGGGGGGCAGTTGG No data
1171896882_1171896892 0 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896892 20:30816071-30816093 GGGTGGTCAAGGGGGAGCAGAGG No data
1171896882_1171896890 -9 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896890 20:30816062-30816084 GGGGCGCGGGGGTGGTCAAGGGG No data
1171896882_1171896891 -8 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896891 20:30816063-30816085 GGGCGCGGGGGTGGTCAAGGGGG No data
1171896882_1171896894 4 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896894 20:30816075-30816097 GGTCAAGGGGGAGCAGAGGCGGG No data
1171896882_1171896895 5 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896895 20:30816076-30816098 GTCAAGGGGGAGCAGAGGCGGGG No data
1171896882_1171896893 3 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896893 20:30816074-30816096 TGGTCAAGGGGGAGCAGAGGCGG No data
1171896882_1171896900 23 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896900 20:30816094-30816116 CGGGGGGCAGTTGGGAAGCACGG No data
1171896882_1171896899 15 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896899 20:30816086-30816108 AGCAGAGGCGGGGGGCAGTTGGG No data
1171896882_1171896889 -10 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896889 20:30816061-30816083 TGGGGCGCGGGGGTGGTCAAGGG No data
1171896882_1171896896 6 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896896 20:30816077-30816099 TCAAGGGGGAGCAGAGGCGGGGG No data
1171896882_1171896897 7 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896897 20:30816078-30816100 CAAGGGGGAGCAGAGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171896882 Original CRISPR CCGCGCCCCAGCCGAAGCCC AGG (reversed) Intergenic