ID: 1171896890

View in Genome Browser
Species Human (GRCh38)
Location 20:30816062-30816084
Sequence GGGGCGCGGGGGTGGTCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171896873_1171896890 29 Left 1171896873 20:30816010-30816032 CCTGTCGGTGCTGCAGCAGCGGA No data
Right 1171896890 20:30816062-30816084 GGGGCGCGGGGGTGGTCAAGGGG No data
1171896882_1171896890 -9 Left 1171896882 20:30816048-30816070 CCTGGGCTTCGGCTGGGGCGCGG No data
Right 1171896890 20:30816062-30816084 GGGGCGCGGGGGTGGTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171896890 Original CRISPR GGGGCGCGGGGGTGGTCAAG GGG Intergenic
No off target data available for this crispr