ID: 1171898803

View in Genome Browser
Species Human (GRCh38)
Location 20:30836915-30836937
Sequence ATGGCTATTTCTGCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171898803_1171898806 19 Left 1171898803 20:30836915-30836937 CCAACAAAAGCAGAAATAGCCAT No data
Right 1171898806 20:30836957-30836979 AGATTTCAACAAAAGACTGTAGG 0: 8
1: 4
2: 4
3: 56
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171898803 Original CRISPR ATGGCTATTTCTGCTTTTGT TGG (reversed) Intergenic
No off target data available for this crispr