ID: 1171899024

View in Genome Browser
Species Human (GRCh38)
Location 20:30839858-30839880
Sequence GAGGAACTCAAGCTGGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171899020_1171899024 14 Left 1171899020 20:30839821-30839843 CCTAGTCATGTGGCTGAAATATA No data
Right 1171899024 20:30839858-30839880 GAGGAACTCAAGCTGGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171899024 Original CRISPR GAGGAACTCAAGCTGGATAT GGG Intergenic
No off target data available for this crispr