ID: 1171902163

View in Genome Browser
Species Human (GRCh38)
Location 20:30868184-30868206
Sequence CACTGTGTGCAGGTTGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171902163_1171902165 -7 Left 1171902163 20:30868184-30868206 CCTTGTGCAACCTGCACACAGTG No data
Right 1171902165 20:30868200-30868222 CACAGTGACCTGTAGTCTAGAGG No data
1171902163_1171902166 -6 Left 1171902163 20:30868184-30868206 CCTTGTGCAACCTGCACACAGTG No data
Right 1171902166 20:30868201-30868223 ACAGTGACCTGTAGTCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171902163 Original CRISPR CACTGTGTGCAGGTTGCACA AGG (reversed) Intergenic
No off target data available for this crispr