ID: 1171903522

View in Genome Browser
Species Human (GRCh38)
Location 20:30879033-30879055
Sequence TCCACATGGTCCTCAACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171903522_1171903530 23 Left 1171903522 20:30879033-30879055 CCGGCAGTTGAGGACCATGTGGA No data
Right 1171903530 20:30879079-30879101 CCAACCTGACAGCAGAACAGGGG No data
1171903522_1171903523 -10 Left 1171903522 20:30879033-30879055 CCGGCAGTTGAGGACCATGTGGA No data
Right 1171903523 20:30879046-30879068 ACCATGTGGAGAACAACTACTGG No data
1171903522_1171903526 21 Left 1171903522 20:30879033-30879055 CCGGCAGTTGAGGACCATGTGGA No data
Right 1171903526 20:30879077-30879099 TCCCAACCTGACAGCAGAACAGG No data
1171903522_1171903528 22 Left 1171903522 20:30879033-30879055 CCGGCAGTTGAGGACCATGTGGA No data
Right 1171903528 20:30879078-30879100 CCCAACCTGACAGCAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171903522 Original CRISPR TCCACATGGTCCTCAACTGC CGG (reversed) Intergenic
No off target data available for this crispr