ID: 1171906000

View in Genome Browser
Species Human (GRCh38)
Location 20:30900001-30900023
Sequence GAGGAGTGTTTCCAGCGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171905987_1171906000 29 Left 1171905987 20:30899949-30899971 CCAAACCCGCGTCCTAAAGCTCC No data
Right 1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG No data
1171905988_1171906000 24 Left 1171905988 20:30899954-30899976 CCCGCGTCCTAAAGCTCCTCCAG 0: 41
1: 10
2: 4
3: 14
4: 110
Right 1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG No data
1171905995_1171906000 -4 Left 1171905995 20:30899982-30900004 CCCGGTGTTCTTCCTGGCTGAGG No data
Right 1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG No data
1171905997_1171906000 -5 Left 1171905997 20:30899983-30900005 CCGGTGTTCTTCCTGGCTGAGGA No data
Right 1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG No data
1171905990_1171906000 17 Left 1171905990 20:30899961-30899983 CCTAAAGCTCCTCCAGCAGAGCC No data
Right 1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG No data
1171905989_1171906000 23 Left 1171905989 20:30899955-30899977 CCGCGTCCTAAAGCTCCTCCAGC No data
Right 1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG No data
1171905992_1171906000 8 Left 1171905992 20:30899970-30899992 CCTCCAGCAGAGCCCGGTGTTCT No data
Right 1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG No data
1171905993_1171906000 5 Left 1171905993 20:30899973-30899995 CCAGCAGAGCCCGGTGTTCTTCC No data
Right 1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG No data
1171905986_1171906000 30 Left 1171905986 20:30899948-30899970 CCCAAACCCGCGTCCTAAAGCTC No data
Right 1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171906000 Original CRISPR GAGGAGTGTTTCCAGCGGAG CGG Intergenic
No off target data available for this crispr