ID: 1171906119

View in Genome Browser
Species Human (GRCh38)
Location 20:30900542-30900564
Sequence CCAGCCCAGCCAGGCTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171906119_1171906134 25 Left 1171906119 20:30900542-30900564 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG No data
1171906119_1171906128 4 Left 1171906119 20:30900542-30900564 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1171906128 20:30900569-30900591 GGGGGAAGGCCCTTGCTCCCTGG No data
1171906119_1171906127 -10 Left 1171906119 20:30900542-30900564 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1171906127 20:30900555-30900577 GCTGGGCTGGAGCGGGGGGAAGG No data
1171906119_1171906133 24 Left 1171906119 20:30900542-30900564 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1171906133 20:30900589-30900611 TGGCTCATGAAAGCCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171906119 Original CRISPR CCAGCCCAGCCAGGCTGCGC AGG (reversed) Intergenic
No off target data available for this crispr