ID: 1171906125

View in Genome Browser
Species Human (GRCh38)
Location 20:30900551-30900573
Sequence CCCCCCGCTCCAGCCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171906125_1171906134 16 Left 1171906125 20:30900551-30900573 CCTGGCTGGGCTGGAGCGGGGGG No data
Right 1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG No data
1171906125_1171906135 27 Left 1171906125 20:30900551-30900573 CCTGGCTGGGCTGGAGCGGGGGG No data
Right 1171906135 20:30900601-30900623 GCCCCATGTGGGAGAGCCCCAGG No data
1171906125_1171906133 15 Left 1171906125 20:30900551-30900573 CCTGGCTGGGCTGGAGCGGGGGG No data
Right 1171906133 20:30900589-30900611 TGGCTCATGAAAGCCCCATGTGG No data
1171906125_1171906128 -5 Left 1171906125 20:30900551-30900573 CCTGGCTGGGCTGGAGCGGGGGG No data
Right 1171906128 20:30900569-30900591 GGGGGAAGGCCCTTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171906125 Original CRISPR CCCCCCGCTCCAGCCCAGCC AGG (reversed) Intergenic
No off target data available for this crispr