ID: 1171906134

View in Genome Browser
Species Human (GRCh38)
Location 20:30900590-30900612
Sequence GGCTCATGAAAGCCCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171906119_1171906134 25 Left 1171906119 20:30900542-30900564 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG No data
1171906125_1171906134 16 Left 1171906125 20:30900551-30900573 CCTGGCTGGGCTGGAGCGGGGGG No data
Right 1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171906134 Original CRISPR GGCTCATGAAAGCCCCATGT GGG Intergenic
No off target data available for this crispr