ID: 1171906457

View in Genome Browser
Species Human (GRCh38)
Location 20:30903606-30903628
Sequence GGTTCCAGACAACCACAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171906457_1171906461 9 Left 1171906457 20:30903606-30903628 CCTTATTGTGGTTGTCTGGAACC No data
Right 1171906461 20:30903638-30903660 CTATCTCTGAGTATGCTTGTAGG No data
1171906457_1171906462 16 Left 1171906457 20:30903606-30903628 CCTTATTGTGGTTGTCTGGAACC No data
Right 1171906462 20:30903645-30903667 TGAGTATGCTTGTAGGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171906457 Original CRISPR GGTTCCAGACAACCACAATA AGG (reversed) Intergenic
No off target data available for this crispr