ID: 1171907568

View in Genome Browser
Species Human (GRCh38)
Location 20:30912378-30912400
Sequence ACGTGGGTAGTGAGGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171907568_1171907578 11 Left 1171907568 20:30912378-30912400 CCAGCTCCCCTCACTACCCACGT No data
Right 1171907578 20:30912412-30912434 CGTTTAGTGAGTCAGTTAGGTGG No data
1171907568_1171907579 12 Left 1171907568 20:30912378-30912400 CCAGCTCCCCTCACTACCCACGT No data
Right 1171907579 20:30912413-30912435 GTTTAGTGAGTCAGTTAGGTGGG No data
1171907568_1171907577 8 Left 1171907568 20:30912378-30912400 CCAGCTCCCCTCACTACCCACGT No data
Right 1171907577 20:30912409-30912431 CTTCGTTTAGTGAGTCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171907568 Original CRISPR ACGTGGGTAGTGAGGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr