ID: 1171933134

View in Genome Browser
Species Human (GRCh38)
Location 20:31246576-31246598
Sequence TGCTAGAGTGCTTCCTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171933131_1171933134 5 Left 1171933131 20:31246548-31246570 CCTTGTGCCATCTTGAAGCTAGA No data
Right 1171933134 20:31246576-31246598 TGCTAGAGTGCTTCCTACTCTGG No data
1171933129_1171933134 25 Left 1171933129 20:31246528-31246550 CCTGGTTTGTGCTGCTACCTCCT No data
Right 1171933134 20:31246576-31246598 TGCTAGAGTGCTTCCTACTCTGG No data
1171933130_1171933134 8 Left 1171933130 20:31246545-31246567 CCTCCTTGTGCCATCTTGAAGCT No data
Right 1171933134 20:31246576-31246598 TGCTAGAGTGCTTCCTACTCTGG No data
1171933132_1171933134 -2 Left 1171933132 20:31246555-31246577 CCATCTTGAAGCTAGAACCACTG No data
Right 1171933134 20:31246576-31246598 TGCTAGAGTGCTTCCTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171933134 Original CRISPR TGCTAGAGTGCTTCCTACTC TGG Intergenic
No off target data available for this crispr