ID: 1171934107

View in Genome Browser
Species Human (GRCh38)
Location 20:31257347-31257369
Sequence CTGTGAGAATGTAGGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171934100_1171934107 20 Left 1171934100 20:31257304-31257326 CCAGTGTGTCATGATAAACACAC No data
Right 1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171934107 Original CRISPR CTGTGAGAATGTAGGGGAGG GGG Intergenic
No off target data available for this crispr