ID: 1171936455

View in Genome Browser
Species Human (GRCh38)
Location 20:31278993-31279015
Sequence CAAATTGATGTTTCCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171936452_1171936455 19 Left 1171936452 20:31278951-31278973 CCTTGGCTCCTTTAAAGCTATTT No data
Right 1171936455 20:31278993-31279015 CAAATTGATGTTTCCACAGTGGG No data
1171936453_1171936455 11 Left 1171936453 20:31278959-31278981 CCTTTAAAGCTATTTTTGTATGT No data
Right 1171936455 20:31278993-31279015 CAAATTGATGTTTCCACAGTGGG No data
1171936451_1171936455 27 Left 1171936451 20:31278943-31278965 CCTGGTTTCCTTGGCTCCTTTAA No data
Right 1171936455 20:31278993-31279015 CAAATTGATGTTTCCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171936455 Original CRISPR CAAATTGATGTTTCCACAGT GGG Intergenic
No off target data available for this crispr