ID: 1171941129

View in Genome Browser
Species Human (GRCh38)
Location 20:31330955-31330977
Sequence AAGGAGAAGGAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7687
Summary {0: 7, 1: 38, 2: 244, 3: 1319, 4: 6079}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171941121_1171941129 25 Left 1171941121 20:31330907-31330929 CCAGCTTGGGCAATGAAAGGAGA No data
Right 1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG 0: 7
1: 38
2: 244
3: 1319
4: 6079
1171941124_1171941129 2 Left 1171941124 20:31330930-31330952 CCCTCTCTCTAAGGAAAGGAAGA No data
Right 1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG 0: 7
1: 38
2: 244
3: 1319
4: 6079
1171941119_1171941129 30 Left 1171941119 20:31330902-31330924 CCAGTCCAGCTTGGGCAATGAAA No data
Right 1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG 0: 7
1: 38
2: 244
3: 1319
4: 6079
1171941125_1171941129 1 Left 1171941125 20:31330931-31330953 CCTCTCTCTAAGGAAAGGAAGAA No data
Right 1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG 0: 7
1: 38
2: 244
3: 1319
4: 6079

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171941129 Original CRISPR AAGGAGAAGGAGAAGGAAGA AGG Intergenic
Too many off-targets to display for this crispr