ID: 1171942489

View in Genome Browser
Species Human (GRCh38)
Location 20:31344933-31344955
Sequence GCCCATAGGGAGGGATCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171942489_1171942495 -5 Left 1171942489 20:31344933-31344955 CCTCAGGATCCCTCCCTATGGGC No data
Right 1171942495 20:31344951-31344973 TGGGCAGCCTGAGGTCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171942489 Original CRISPR GCCCATAGGGAGGGATCCTG AGG (reversed) Intergenic
No off target data available for this crispr