ID: 1171942787

View in Genome Browser
Species Human (GRCh38)
Location 20:31347933-31347955
Sequence AAAGGGGGTGCAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171942773_1171942787 24 Left 1171942773 20:31347886-31347908 CCCATCCCTTGGTAGCAGCTGCA No data
Right 1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG No data
1171942776_1171942787 19 Left 1171942776 20:31347891-31347913 CCCTTGGTAGCAGCTGCATGGTG No data
Right 1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG No data
1171942772_1171942787 29 Left 1171942772 20:31347881-31347903 CCTCTCCCATCCCTTGGTAGCAG No data
Right 1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG No data
1171942777_1171942787 18 Left 1171942777 20:31347892-31347914 CCTTGGTAGCAGCTGCATGGTGC No data
Right 1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG No data
1171942774_1171942787 23 Left 1171942774 20:31347887-31347909 CCATCCCTTGGTAGCAGCTGCAT No data
Right 1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171942787 Original CRISPR AAAGGGGGTGCAGTGATTGT GGG Intergenic
No off target data available for this crispr