ID: 1171946002

View in Genome Browser
Species Human (GRCh38)
Location 20:31378136-31378158
Sequence TGCCTTCTTCCCACCAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171946002_1171946005 1 Left 1171946002 20:31378136-31378158 CCCTATCTGGTGGGAAGAAGGCA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1171946005 20:31378160-31378182 CCCTCCCTCCACTTCCCTGATGG 0: 1
1: 0
2: 6
3: 65
4: 458
1171946002_1171946011 6 Left 1171946002 20:31378136-31378158 CCCTATCTGGTGGGAAGAAGGCA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1171946011 20:31378165-31378187 CCTCCACTTCCCTGATGGGGTGG 0: 1
1: 1
2: 16
3: 241
4: 2149
1171946002_1171946015 17 Left 1171946002 20:31378136-31378158 CCCTATCTGGTGGGAAGAAGGCA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1171946015 20:31378176-31378198 CTGATGGGGTGGTGACAGAGAGG No data
1171946002_1171946007 2 Left 1171946002 20:31378136-31378158 CCCTATCTGGTGGGAAGAAGGCA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1171946007 20:31378161-31378183 CCTCCCTCCACTTCCCTGATGGG 0: 1
1: 0
2: 7
3: 48
4: 363
1171946002_1171946008 3 Left 1171946002 20:31378136-31378158 CCCTATCTGGTGGGAAGAAGGCA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1171946008 20:31378162-31378184 CTCCCTCCACTTCCCTGATGGGG 0: 1
1: 0
2: 3
3: 50
4: 662
1171946002_1171946016 18 Left 1171946002 20:31378136-31378158 CCCTATCTGGTGGGAAGAAGGCA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1171946016 20:31378177-31378199 TGATGGGGTGGTGACAGAGAGGG 0: 1
1: 0
2: 9
3: 77
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171946002 Original CRISPR TGCCTTCTTCCCACCAGATA GGG (reversed) Intronic
901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG + Intronic
902200367 1:14828870-14828892 TGCCTTCTTCCTGCCTGAAATGG - Intronic
904433170 1:30478292-30478314 TCCCTCCTTCCCACCACACATGG - Intergenic
906667303 1:47630992-47631014 GGCCTTCTTCCCACCTGGTGAGG - Intergenic
907891621 1:58641987-58642009 TGTCTACTTCCCACTAGACAAGG + Intergenic
908291663 1:62673235-62673257 ATCCTTTTTCCCACCAGAAAAGG - Intronic
909396030 1:75171779-75171801 TCCCTTCTTTCCACCAAAGAAGG + Intergenic
909526097 1:76624283-76624305 TGCCATCTTACCACCTAATAAGG - Intronic
915518678 1:156428934-156428956 TCCCTTCTCTCCACCAGACATGG - Intronic
915632982 1:157166340-157166362 GGGCTTTTTCCCACCAGAAATGG + Intergenic
916621947 1:166508390-166508412 TACATTCTTACTACCAGATAAGG + Intergenic
917997460 1:180455647-180455669 TGCCTTCTTTACCCCAGATTTGG - Intronic
919826300 1:201505916-201505938 TGCCTTCCTCCCAGAAGCTAAGG - Intronic
924032370 1:239898905-239898927 TGCCTTCTTCCCCCTAGTTATGG - Intronic
1066503185 10:36014717-36014739 TGCCTCCTTCCCACCTGAGCTGG - Intergenic
1068446026 10:57125020-57125042 TGACTTCTTGACACCAGCTATGG + Intergenic
1070335598 10:75452464-75452486 TTGCTTCTTGCCACAAGATAAGG + Intronic
1071797725 10:89024149-89024171 TGTCTTCTTCCCTCCAGCTTTGG + Intergenic
1072794953 10:98347453-98347475 TGCCTCCTTGCCCCCAGTTATGG - Intergenic
1073717229 10:106121332-106121354 TCCCTACTACCCACCTGATACGG - Intergenic
1075041853 10:119114368-119114390 TGCCTGCTCCTCACCAGAAATGG - Intronic
1077699201 11:4424376-4424398 TGCTTTCTCCCCACCACATGAGG - Intergenic
1077847170 11:6038428-6038450 TTCCTTCTGCCCAACAGAAAGGG - Intergenic
1080987611 11:37488601-37488623 TGTCTTCTTCCCCCCAAAGATGG + Intergenic
1081980283 11:47261811-47261833 TCCCTGCTTCCCAGCAGATTTGG - Intronic
1081992536 11:47345565-47345587 TGCCTTCTCCCCACCATGTCTGG - Intronic
1083465315 11:62841844-62841866 TCCCATCTTCCAACCAGTTATGG + Intergenic
1083918240 11:65764188-65764210 TGCCTGATTCTCACCAAATAGGG + Intergenic
1084616152 11:70237284-70237306 TCCCTTCTTCCCTCCAGTCAAGG - Intergenic
1085236321 11:75018258-75018280 TGCCTTCTTCCCACTTGTGATGG + Intronic
1085331360 11:75654527-75654549 TGCCTTCCTCCCACTAGACCAGG + Intronic
1086496238 11:87406906-87406928 TGCCTTCTACCCTGCACATATGG + Intergenic
1088683597 11:112266223-112266245 GGCCTCCTTCCCACCAGCTGGGG + Intronic
1089138828 11:116270424-116270446 TGACTTCTTTCCACCAGGCAGGG + Intergenic
1093733493 12:22592574-22592596 TGCCTCCTTTCCCCCAGAGAAGG + Intergenic
1095954090 12:47796727-47796749 TGCTTTCTTCCCATCAGAGCAGG + Intronic
1095958969 12:47821699-47821721 TCCCTCCCTCCCACTAGATAGGG - Intronic
1100639667 12:96470554-96470576 TGCCTTATTACCACCAGATGAGG + Intergenic
1101044337 12:100789080-100789102 TACCTTCTTCCCACCACTCATGG + Intronic
1101553289 12:105783606-105783628 TGCCTTCTTTCCACCATGTGAGG - Intergenic
1102475554 12:113185950-113185972 CACCTTCTTCCCACCAGGTCTGG - Exonic
1105239295 13:18595977-18595999 GTCCTTCTCCCCACCAGAGAGGG + Intergenic
1105540362 13:21311088-21311110 TGCCTTCAGCCCACTAGTTAAGG + Intergenic
1107937662 13:45358617-45358639 TGCCCTCTTCCCAGAATATATGG + Intergenic
1109724916 13:66327311-66327333 ACCCTTCTTTCCACCAAATATGG - Intronic
1112252751 13:97798401-97798423 TTTCTGATTCCCACCAGATAGGG - Intergenic
1112419846 13:99238410-99238432 TTCCTTTTTCCCTCCAGACAAGG + Exonic
1113956122 13:114100592-114100614 CGCCTTCTTCCCAACTGCTAGGG - Intronic
1114064663 14:19051052-19051074 GCCCTTCTCCCCACCAGAGAGGG + Intergenic
1114097598 14:19348950-19348972 GCCCTTCTCCCCACCAGAGAGGG - Intergenic
1114134667 14:19834362-19834384 GGCAGTCTTCCCATCAGATAGGG + Intergenic
1117758623 14:59002684-59002706 TACCTTCTTCCTTCCAGACAAGG - Intergenic
1118129121 14:62942415-62942437 TGACTTCTCCCCACCGGAAAAGG - Intronic
1120016767 14:79482752-79482774 TGCAGTCTTTCCACCAGAGAGGG - Intronic
1120499824 14:85282056-85282078 TTCCTCCTTCCCAGCAGAAAGGG + Intergenic
1120655606 14:87186373-87186395 TGCATTCTTCCCAGCAGCTCAGG - Intergenic
1121230400 14:92353508-92353530 AGCCTTTGTCCCACCAGACATGG + Intronic
1123491950 15:20788109-20788131 GCCCTTCTCCCCACCAGAGAAGG - Intergenic
1123548455 15:21357199-21357221 GCCCTTCTCCCCACCAGAGAAGG - Intergenic
1127305896 15:57705705-57705727 TGCCTTCTTCTCAACAGCTGGGG + Intronic
1131681203 15:94725583-94725605 TACCATCTACCCTCCAGATACGG - Intergenic
1131849609 15:96524847-96524869 TGCCTTCTTCCCACCACCCTGGG - Intergenic
1131907983 15:97164851-97164873 CCCCATCTTCCCAACAGATATGG - Intergenic
1202956788 15_KI270727v1_random:84430-84452 GCCCTTCTCCCCACCAGAGAAGG - Intergenic
1132582712 16:692959-692981 TACTCTCTTCCAACCAGATAGGG + Exonic
1132843901 16:1991172-1991194 TGCCTCCTGCCCACCAGTTCCGG - Intronic
1133800688 16:9082686-9082708 TGGCTTCTACCCACTAGATGTGG + Intergenic
1133996682 16:10753640-10753662 TGCCTTCTCCCACCCAGACAGGG - Intronic
1135486429 16:22869718-22869740 TGGGTTCTTCCCACCACATGTGG + Intronic
1136511374 16:30739856-30739878 TCCCTTCTTCCCACCAAAGTAGG + Exonic
1142192877 16:88725915-88725937 TGCCTTCTTCCCTGCAGCTGTGG - Intronic
1146974059 17:37096065-37096087 TGCCTACTTCCAATCAGAGATGG - Intronic
1149540841 17:57466992-57467014 TCCCTTCTGCTCACAAGATAAGG - Intronic
1149829252 17:59856718-59856740 TGCCACCTACCCACCAAATATGG - Intergenic
1151348942 17:73520207-73520229 GGCCTGCTTCCCTCCAGATTGGG - Intronic
1151966629 17:77434875-77434897 TCCCCTCTTCCCTCCAGCTATGG - Intronic
1154449499 18:14462660-14462682 GCCCTTCTCCCCACCAGAGAGGG - Intergenic
1155959182 18:31979167-31979189 TGCCTCCTTGCCACTAGTTATGG - Intergenic
1156009757 18:32483123-32483145 TGCCATCTTTCCTCCAGATGTGG - Intergenic
1157564782 18:48672634-48672656 TTCCTTCTTGCCTCCAGGTAGGG - Intronic
1158774571 18:60562398-60562420 TACCTATTTCCCACCATATATGG + Intergenic
1158945392 18:62443047-62443069 TGTCTACCTCCCAGCAGATATGG + Intergenic
1162377738 19:10315272-10315294 CGTCTTTTTCCCACCAAATATGG - Intronic
1163337281 19:16681569-16681591 CGCTTCCTGCCCACCAGATATGG + Intronic
1164596367 19:29533123-29533145 GCCCTTCTTCCCAGAAGATATGG + Intronic
1164807686 19:31129459-31129481 TGCTGTCTTCCCACCAAATGAGG + Intergenic
1165175284 19:33925072-33925094 TGCCATCTTCCCAGCAGAATTGG - Intergenic
1167604919 19:50476520-50476542 CGGCTTCTTCCCACCAGCGAAGG - Exonic
925388011 2:3476367-3476389 GGCATTCTTCCCACCAGCCACGG + Intronic
927416577 2:22886625-22886647 AGCCCTCTTCCCACCATATGAGG + Intergenic
927523874 2:23720158-23720180 TTCATTCTTCCCACAAGAAAGGG + Intergenic
927889801 2:26741294-26741316 TGCCTGCTTCCCTTCAGATGAGG + Intergenic
929545587 2:42853506-42853528 TGCCTTCCACCCAGCAGACATGG + Intergenic
929969701 2:46563505-46563527 TATCTTCTTCCCACCAGCTCTGG - Intronic
932044153 2:68330519-68330541 TGCCCTCATCCCACCAAAGATGG - Intergenic
932133040 2:69204704-69204726 TGCCTTCTCCTCAAGAGATAAGG - Intronic
933173290 2:79149055-79149077 TTCCTTTTTCTCACCAGTTATGG + Intergenic
934105020 2:88687653-88687675 TGCCTACATCCCAGCTGATATGG + Intergenic
934587460 2:95514941-95514963 TGCCTTCTTCCCAGCAGAGGCGG - Intergenic
935240508 2:101174067-101174089 TTCCTGCTTCACACCAGATCTGG - Intronic
938481942 2:131670084-131670106 GCCCTTCTCCCCACCAGAGAGGG + Intergenic
938893821 2:135731480-135731502 TACCTGCTTACCACCAGAGAAGG - Intergenic
944202205 2:197119762-197119784 TCCCTTCTTCCCAGCACACAGGG - Intronic
944508867 2:200444775-200444797 TTCCTCCTTCCCAACAGACAGGG + Intronic
945213954 2:207413433-207413455 TGCCTTATTCCCAGCCGCTATGG - Intergenic
946770922 2:223087353-223087375 AGCCTTCTACCCAGCAGAGAAGG - Intronic
948304234 2:236934803-236934825 TCCCTTCTTCTCAACACATAAGG + Intergenic
1169533191 20:6507301-6507323 TGCCTTAATCCCTCCAGGTATGG - Intergenic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1170905154 20:20508481-20508503 TGCCTTCTTGCCACTACATGGGG - Intronic
1171013318 20:21520357-21520379 TGCCTCCCTCCCACCACAAAAGG + Intergenic
1171946002 20:31378136-31378158 TGCCTTCTTCCCACCAGATAGGG - Intronic
1172948033 20:38703576-38703598 TGCCATCAACCCACCATATAGGG - Intergenic
1173401946 20:42733826-42733848 TGCCTGCTTCTCCCCAGATCTGG - Intronic
1173815258 20:45983407-45983429 AGCCTTCTTCCCAGCAGAGCTGG + Intergenic
1177026452 21:15926623-15926645 TGCCTTCTGCCATCCACATAAGG - Intergenic
1179456812 21:41506223-41506245 TCCCTTATTCCCACCAGCCAAGG - Intronic
1180483151 22:15773674-15773696 GCCCTTCTCCCCACCAGAGAGGG + Intergenic
1180922042 22:19525980-19526002 TGGCCTCTCCCCACCAGGTATGG + Intronic
1184838536 22:47038522-47038544 TGCGTTCTTCCCACAGGACAGGG + Intronic
949897191 3:8776693-8776715 TGCCTTTCTCCTACCAGAGATGG - Intronic
950268051 3:11589778-11589800 TGCTTTCTCCCCACCACATAAGG - Intronic
951913363 3:27774209-27774231 TTCCTCCTTCCCACCAGCTGAGG - Intergenic
951924683 3:27895810-27895832 TGCCTTGTTTCCACCTGATAGGG - Intergenic
954099567 3:48358701-48358723 TGTCTTACTACCACCAGATAGGG - Intergenic
955189083 3:56743671-56743693 TGCCTATTTCCTCCCAGATAGGG - Intronic
956040516 3:65140398-65140420 TGCCCTCTTGCCATCAGGTAAGG + Intergenic
957868958 3:86063216-86063238 TCACTTCTTTTCACCAGATATGG - Intronic
958430438 3:94033829-94033851 CAGCTTCTTACCACCAGATACGG + Intronic
958804819 3:98797486-98797508 TGCTCTCTTCCCACCTGAAAAGG + Exonic
959196859 3:103194276-103194298 TGCTTTCTTTACACCAGATGTGG + Intergenic
961020464 3:123501885-123501907 TGCTTTCCTTCCACCAAATAAGG + Intronic
961617420 3:128193815-128193837 TGCCTTCCTCCCTCCAGAGGAGG + Intronic
964928903 3:161991569-161991591 TGCCTTCTTCCCACAGGGAATGG - Intergenic
966412317 3:179656479-179656501 TCCCTTCTTCCCACCTCCTAGGG + Intronic
967021800 3:185529268-185529290 AGCCTTCTTCACTCCAGGTAGGG - Intronic
969681560 4:8646026-8646048 TGCCTCCTTCCCTGCAGACAAGG - Intergenic
970986943 4:22170118-22170140 TGCTTTCATCCCACTAGAGAAGG + Intergenic
974666768 4:64971950-64971972 TGCCTTCACCACACCAGATATGG + Intergenic
978252959 4:106655302-106655324 TGCATTTTTCCCATAAGATAAGG + Intergenic
978354321 4:107854952-107854974 TGCCTTCCTCCAAACACATATGG + Intronic
979109444 4:116733503-116733525 AGACTGCTTCCAACCAGATAAGG + Intergenic
979669750 4:123349668-123349690 TGACTACATCCAACCAGATAAGG - Intergenic
980689754 4:136280208-136280230 TTCATTCTTTCCACCACATAAGG + Intergenic
981583644 4:146275631-146275653 TGGATTCTTTCCAGCAGATAAGG + Intronic
981958954 4:150512523-150512545 AGCCCTCTTTCCACCAGGTAAGG + Intronic
982630075 4:157820449-157820471 TGCCTTCTTTCCTCCAAATGAGG + Intergenic
983427568 4:167606736-167606758 TCCCTCCTTGCCACCATATAAGG - Intergenic
985338931 4:188927150-188927172 AGACTGCTTCCAACCAGATAAGG + Intergenic
985867898 5:2529666-2529688 TGGGTTTTTCCCACCAGATACGG - Intergenic
988067715 5:26243033-26243055 TGCCCTCTTCCCACCATGTGGGG - Intergenic
988650118 5:33139867-33139889 TGCCTTCTTTCCACCATGTGAGG - Intergenic
992014867 5:72565531-72565553 TGCCCTATCCCCACCCGATAAGG + Intergenic
992137608 5:73763162-73763184 CCCCTTCCTCCCTCCAGATATGG + Intronic
993601075 5:89925515-89925537 AGCCTTCTTCCCATCAGAGGTGG - Intergenic
993941416 5:94063152-94063174 TGCCCTCTTCCCACCACCTGTGG - Intronic
994112725 5:96025306-96025328 TCCCTGCTTCCCACCAGGTGAGG - Intergenic
1001663944 5:173416941-173416963 TGCCTTCTTCCCTCCATCTTAGG + Intergenic
1005358759 6:25010268-25010290 TCCCCTCTTCCCACCAGAGCTGG + Intronic
1005696180 6:28354764-28354786 TGACTTCCTCCAACCAGGTATGG - Intronic
1006406672 6:33849592-33849614 TGCCTCCTTCCCACCCTGTAGGG - Intergenic
1006631868 6:35435946-35435968 TGCCTTCCTCCCATCCGATGTGG + Intergenic
1007361632 6:41360765-41360787 TGCCATCCTCCCCCCAGAAAAGG - Intergenic
1008784675 6:55152659-55152681 TGCCCTCTTTCTACCAGATGAGG - Intronic
1011240176 6:85263805-85263827 TGACTTCTTCTCACCAGGTTTGG - Intergenic
1012612773 6:101236060-101236082 TACCTTCTTTCCACCATATGAGG + Intergenic
1015988520 6:138911033-138911055 TGCATTCTTCCCACTATATAAGG - Intronic
1017054257 6:150423853-150423875 TGCCTCCTTCTCTCCAGATCAGG + Intergenic
1017950341 6:159130525-159130547 TCACTTCTTCCCACCAGCTGAGG - Intergenic
1019842585 7:3463034-3463056 TGCCTTGTTCCCTCCTGCTATGG + Intronic
1020399254 7:7756538-7756560 AGCCATCTTGCCACCAGAAAGGG - Intronic
1021891639 7:25191827-25191849 TGTCTGCTTTCCACCAGGTAAGG - Intergenic
1024196997 7:47069023-47069045 CACCTTCTTTCCACCACATAAGG + Intergenic
1030145527 7:106350224-106350246 TGCCCTCTTTCCACCATGTAAGG + Intergenic
1031456800 7:121990954-121990976 TGCCTTCTTACCACCTTACAAGG + Intronic
1033138907 7:138807903-138807925 TGCCCTCTTTCCACCACATGAGG - Intronic
1033321710 7:140345809-140345831 TGCCTTATTCCAACCAGATTAGG + Intronic
1033508510 7:142030502-142030524 TGCCCTCTTTCCACCAAATTAGG + Intronic
1033929535 7:146505768-146505790 TGACTTCCTCCAACCAGGTATGG - Intronic
1034637559 7:152579404-152579426 AGCCTTCTTCCCAGCAGGGATGG - Intergenic
1035221781 7:157410521-157410543 TGCCCTCCTCCCACCTGTTAGGG + Intronic
1036114454 8:5943658-5943680 TGCCTTCTTCACAGCTGATTTGG + Intergenic
1036934526 8:12988287-12988309 AACATTCTTCACACCAGATAAGG + Intronic
1039484565 8:37900471-37900493 TGCCCTCCCCCCACCAGATAAGG + Intergenic
1039805900 8:40997933-40997955 TCCCTTCCTCCCTCCACATAAGG + Intergenic
1042347233 8:67740132-67740154 TGCCTCCTTCCCAACTGAGAAGG - Intronic
1042551409 8:69996987-69997009 TACCTTCTTCCAACTGGATAGGG - Intergenic
1042599165 8:70481044-70481066 TGGCTTCTTCCCACCAGCTGTGG + Intergenic
1044547448 8:93475617-93475639 TCCCTTCTTTCCATCAGATCAGG + Intergenic
1045372984 8:101543484-101543506 TTCCTTCTTCCCACCAGCAAAGG - Intronic
1046818429 8:118610658-118610680 TGCCTTCTACAAGCCAGATACGG + Intronic
1047215007 8:122869182-122869204 TGCCTCCTTCCCAGGAGAAAGGG + Intronic
1051475289 9:17500711-17500733 TGCCTTGTTTCCACCAGTAAGGG + Intronic
1051605157 9:18911225-18911247 TCCCATCTTCCCACCACATAGGG - Intergenic
1061879307 9:133560804-133560826 TTCCTTCTTCCCACCGGGGAGGG - Intronic
1185675426 X:1845407-1845429 TGCCATCTTCCAACCAGAACTGG - Intergenic
1187063637 X:15811800-15811822 TTCCCTCTTCCCACAAGGTAGGG - Intronic
1194929783 X:99872717-99872739 TGCAATCTTCCCACCTGACAAGG + Intergenic
1196197682 X:112853118-112853140 TGCCTTCTTCCAAAGAGCTATGG - Intergenic
1196858096 X:120002056-120002078 TCCCGTCTGCCCAGCAGATAAGG + Intergenic
1197637415 X:128930745-128930767 TCTCTTCTTCCCACATGATATGG + Intergenic
1198272769 X:135070338-135070360 CCCCTACTTCACACCAGATATGG + Intergenic
1199758419 X:150886727-150886749 TGGCTTCTGCCCACTAGATGCGG - Intronic
1199853534 X:151741682-151741704 TGCCTCCCTCCCACGAGCTAAGG - Intronic
1200424676 Y:3007985-3008007 TGCCTTCCTGACAACAGATAAGG - Intergenic