ID: 1171948972

View in Genome Browser
Species Human (GRCh38)
Location 20:31404117-31404139
Sequence GAATGGAAAGAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171948967_1171948972 -3 Left 1171948967 20:31404097-31404119 CCCATGGCCACAACTAGAGGGAA No data
Right 1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG No data
1171948962_1171948972 28 Left 1171948962 20:31404066-31404088 CCTGCAAAATGATTAGCCAGCAG No data
Right 1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG No data
1171948964_1171948972 12 Left 1171948964 20:31404082-31404104 CCAGCAGTTTAATGTCCCATGGC No data
Right 1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG No data
1171948970_1171948972 -10 Left 1171948970 20:31404104-31404126 CCACAACTAGAGGGAATGGAAAG No data
Right 1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG No data
1171948968_1171948972 -4 Left 1171948968 20:31404098-31404120 CCATGGCCACAACTAGAGGGAAT No data
Right 1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171948972 Original CRISPR GAATGGAAAGAGATGGAGCA AGG Intergenic
No off target data available for this crispr