ID: 1171968519

View in Genome Browser
Species Human (GRCh38)
Location 20:31548881-31548903
Sequence ATACTAATCTGGGGCAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171968514_1171968519 -9 Left 1171968514 20:31548867-31548889 CCCTTCTGAAACTCATACTAATC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1171968519 20:31548881-31548903 ATACTAATCTGGGGCAGCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1171968512_1171968519 4 Left 1171968512 20:31548854-31548876 CCAGTGAGCTCTCCCCTTCTGAA 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1171968519 20:31548881-31548903 ATACTAATCTGGGGCAGCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1171968513_1171968519 -8 Left 1171968513 20:31548866-31548888 CCCCTTCTGAAACTCATACTAAT 0: 1
1: 0
2: 1
3: 17
4: 208
Right 1171968519 20:31548881-31548903 ATACTAATCTGGGGCAGCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1171968515_1171968519 -10 Left 1171968515 20:31548868-31548890 CCTTCTGAAACTCATACTAATCT 0: 1
1: 0
2: 0
3: 17
4: 242
Right 1171968519 20:31548881-31548903 ATACTAATCTGGGGCAGCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171968519 Original CRISPR ATACTAATCTGGGGCAGCCA AGG Intronic
900364167 1:2304037-2304059 GTCCTCCTCTGGGGCAGCCACGG - Exonic
901087160 1:6617965-6617987 ATACGCATTTCGGGCAGCCAGGG - Intronic
903240118 1:21977110-21977132 TTCCTAATCTAGGGCAGCCCAGG - Intronic
903369689 1:22827207-22827229 ACATTCATCTGGGGAAGCCAGGG - Intronic
904162939 1:28534761-28534783 ATACTATTCTGGGCCAGGCATGG - Intronic
904716595 1:32472521-32472543 ATACTTCTCTGTGTCAGCCAAGG + Intronic
904777362 1:32918875-32918897 ATGCTCATCTTGGCCAGCCACGG - Intergenic
905459457 1:38113148-38113170 GTACCACTATGGGGCAGCCAAGG - Intergenic
907737556 1:57129428-57129450 AAATAGATCTGGGGCAGCCATGG + Intronic
915085026 1:153380645-153380667 ATACTGATCCGGATCAGCCAGGG + Intergenic
915491892 1:156254797-156254819 ATATTAATCTTGGCCAGGCACGG + Intronic
917321070 1:173781756-173781778 ATACAAATCTAGGCCAGGCATGG - Intronic
1068662449 10:59636731-59636753 ACATTAATCAGGGTCAGCCATGG + Intergenic
1068967475 10:62927655-62927677 ATATTAATCTTGAGCAGACACGG - Intergenic
1069772039 10:70906230-70906252 ATCCCAGGCTGGGGCAGCCACGG - Intergenic
1071391206 10:85176984-85177006 AGACTAAGATGGGGCAGCAATGG + Intergenic
1073978057 10:109122708-109122730 ATGCTATTCTAGGGCTGCCATGG - Intergenic
1074679618 10:115891197-115891219 ATTCAAAGCTTGGGCAGCCATGG + Intronic
1076389120 10:130084018-130084040 ATACTATTTTGGGCCAGGCATGG + Intergenic
1077871285 11:6263760-6263782 ATGTTAATCTGGGCCAGACATGG - Intronic
1085199050 11:74690635-74690657 AGACAATGCTGGGGCAGCCAAGG + Intergenic
1089149176 11:116351584-116351606 ATACTTGCCTGGGGCAGACAAGG + Intergenic
1093718764 12:22413859-22413881 ATACTAACCAGCTGCAGCCAGGG + Intronic
1094044271 12:26150081-26150103 ATCCTAACCTAGGGCACCCATGG + Intronic
1098866301 12:75767569-75767591 ATACAGATCTGGGCCAGGCACGG - Intergenic
1099116190 12:78627538-78627560 TAACTAATCAGCGGCAGCCATGG + Intergenic
1115239259 14:31238587-31238609 ATACTGATCTGGGGCAGGTGAGG - Intergenic
1117482162 14:56158316-56158338 ATAAGAATCTTGGGCAGGCACGG - Intronic
1117705109 14:58457556-58457578 ATACTAATGTGGGCCAGGCATGG - Intronic
1121064568 14:90950828-90950850 ATAATGATCTGGGCCTGCCATGG + Intronic
1123149653 14:106168456-106168478 ATATTAATCTTGGCCAGGCATGG - Intergenic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1129903881 15:79172572-79172594 ACTCAAGTCTGGGGCAGCCAGGG - Intergenic
1130356845 15:83140912-83140934 ATACTACTCTGAGGCTGCCATGG - Intronic
1130835818 15:87648912-87648934 CTTTTAATCTTGGGCAGCCAGGG + Intergenic
1131064135 15:89422515-89422537 GTCCTCATCTTGGGCAGCCAAGG - Intergenic
1131096392 15:89657015-89657037 GTACAATTCTGGGCCAGCCAAGG + Intergenic
1136135092 16:28251380-28251402 ATAATAAACCGGGCCAGCCACGG + Intergenic
1136680406 16:31958331-31958353 ATATTAATCTTGGCCAGGCATGG + Intergenic
1136780750 16:32899877-32899899 ATATTAATCTTGGCCAGGCATGG + Intergenic
1136872299 16:33818697-33818719 ATATTAATCTTGGCCAGGCATGG + Intergenic
1136889661 16:33959792-33959814 ATATTAATCTTGGCCAGGCATGG - Intergenic
1139163607 16:64539976-64539998 AGCCATATCTGGGGCAGCCAAGG - Intergenic
1141722635 16:85765308-85765330 ATCCTCAGCTGAGGCAGCCAGGG - Intergenic
1203083405 16_KI270728v1_random:1163906-1163928 ATATTAATCTTGGCCAGGCATGG + Intergenic
1203099873 16_KI270728v1_random:1297371-1297393 ATATTAATCTTGGCCAGGCATGG - Intergenic
1143234042 17:5382456-5382478 ATCCTAGTCTGGGCCAGGCATGG + Intronic
1146031228 17:29367633-29367655 ATACTAATCTAGGCCGGGCAAGG - Intergenic
1146631604 17:34474092-34474114 ATAGTAATAAGAGGCAGCCAGGG - Intergenic
1150866449 17:68855682-68855704 ATATTAAGCTGGGCCAGGCACGG - Intergenic
1151619765 17:75238593-75238615 GTCCTAATCTGGGGCAGCTGGGG + Intronic
1151863204 17:76781654-76781676 ATTTTAATCTGAGGAAGCCATGG + Intergenic
1152030744 17:77841299-77841321 ATTCTAATCTGGGCCAGGCACGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153809473 18:8739300-8739322 ATACTAGTCAGGAGCAGGCAGGG + Intronic
1159166175 18:64703447-64703469 ATAATAAGCTGTGGCAGTCATGG - Intergenic
1159366835 18:67477122-67477144 TTACTAAACTGGGGCTGGCATGG + Intergenic
1159832043 18:73288795-73288817 TTATTAATCTGGGGTTGCCATGG - Intergenic
1163146944 19:15386528-15386550 ACACTAAGCTGGGGGAGGCAGGG - Intronic
1164415914 19:28046400-28046422 ACACTCATCTGGGTGAGCCAAGG + Intergenic
1164416422 19:28049818-28049840 ATGCTAATTGGGGCCAGCCAAGG - Intergenic
1164418135 19:28063133-28063155 ATGCTCATTTGGGCCAGCCAAGG - Intergenic
924964451 2:62390-62412 ATACCACTCTGGGCCAGGCATGG + Intergenic
926136144 2:10337905-10337927 AGACTAAGCCGGCGCAGCCATGG - Intronic
926306636 2:11641774-11641796 AAACCATTCTGGGGCAGGCACGG - Exonic
928838584 2:35577665-35577687 AAATTAATCTTGGACAGCCAGGG + Intergenic
930029150 2:47047820-47047842 AATCTAGTTTGGGGCAGCCAAGG - Intronic
931330352 2:61274984-61275006 ATAATATTCTGGGCCAGGCATGG + Intronic
934109596 2:88729682-88729704 AGAATCATCTGAGGCAGCCATGG + Intronic
935300649 2:101691252-101691274 ATACTATTCTGGGCCAGGCGCGG + Intergenic
935356661 2:102207727-102207749 ATTCCCATCTAGGGCAGCCAAGG - Intronic
937199024 2:120185096-120185118 ATATAAACCTGGGTCAGCCATGG + Intergenic
941092812 2:161197892-161197914 ATATAAATCTGGGGGAGCCAGGG - Intronic
946093174 2:217248617-217248639 ATAGCAGGCTGGGGCAGCCACGG - Intergenic
1170621288 20:17998491-17998513 ACACTATTCTGGGCCAGACATGG - Intronic
1171968519 20:31548881-31548903 ATACTAATCTGGGGCAGCCAAGG + Intronic
1180639313 22:17285596-17285618 ATACAAATCTTGGACAACCAAGG - Intergenic
1184614949 22:45631610-45631632 ATACTGGTCAGGGGCAGCCGTGG - Intergenic
1184771063 22:46596839-46596861 AGCCTAATCTGGGCCAGGCATGG - Intronic
1185130465 22:49035886-49035908 ACACTTATGTGGGGCAGCCGAGG - Intergenic
953266586 3:41395259-41395281 AGCCAAATCTGGGGCAGCCGTGG + Intronic
954055819 3:48023838-48023860 ATACTCATCTGGGGATGGCAGGG + Intronic
956239523 3:67114132-67114154 ATTCTTATCTGGGGCAAACATGG - Intergenic
957187108 3:76956265-76956287 AAGCTAATCTGGGCCAGGCACGG + Intronic
958435324 3:94088957-94088979 ATAATAATCTGGGCCAGGCGTGG - Intronic
962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG + Intronic
962855993 3:139345100-139345122 ATACTCATCTCTGGCACCCAGGG - Intronic
963002224 3:140692735-140692757 ATGCGGATGTGGGGCAGCCACGG - Intronic
963077066 3:141356587-141356609 ATACCAATCAAGGGAAGCCAGGG + Intronic
964229294 3:154444741-154444763 ATACAAAACTGGGCCAGGCATGG + Intergenic
967927107 3:194659350-194659372 AAAATAATCTGGGCCAGGCATGG + Intronic
969419508 4:7083862-7083884 ATAGAAATCTGGGGCAGGGAGGG - Intergenic
970314401 4:14815518-14815540 ATACTTCTCTGTGGCAGGCAGGG - Intergenic
972964436 4:44492021-44492043 ATACCAATCTAGGTCATCCATGG + Intergenic
976769002 4:88631165-88631187 GTACTACTCTGGGCCAGGCATGG + Intronic
981304572 4:143232888-143232910 ATACAAATATGGGGGAACCAAGG - Intergenic
982038866 4:151375082-151375104 ATTCTAGTCTGGGGCAGGAAAGG - Intergenic
987522665 5:19006838-19006860 AGAATAATCTGGGTCAGCAAAGG - Intergenic
988896468 5:35679582-35679604 ATACTAGTCTAGGACACCCAAGG + Intronic
989708425 5:44366503-44366525 GGACTAAGCTGGGGCAGGCATGG + Intronic
992399062 5:76395050-76395072 ATAATAATCGGTTGCAGCCAAGG + Intergenic
993525512 5:88960895-88960917 ATAGCAATCTGGGCCAGACATGG + Intergenic
994476208 5:100273429-100273451 ATAGTGATCTGTGGCAGCCATGG - Intergenic
995498207 5:112772373-112772395 AAAATACTCTGGGGAAGCCAAGG - Intronic
995897733 5:117034269-117034291 CTCCTTCTCTGGGGCAGCCATGG - Intergenic
997495441 5:134320323-134320345 AAACAAATCTTGGCCAGCCATGG + Intronic
1002509922 5:179708126-179708148 ATATTATACTGGGGCAGCCGTGG - Intronic
1007121964 6:39389738-39389760 TTACAAATCTGGGCCAGGCATGG + Intronic
1008132678 6:47736826-47736848 AAACTAATTTGGGGAATCCAAGG - Intergenic
1008177690 6:48288600-48288622 ACACCCATCTGGGGCAGCTAAGG - Intergenic
1008899643 6:56596315-56596337 ATCCTAATCTGGGCCAGGCGTGG - Intronic
1009618989 6:66046927-66046949 ATATAAATTTGGGGGAGCCAGGG + Intergenic
1013511036 6:110844446-110844468 ATACTAAACTTGGCCAGGCAAGG - Intronic
1014985193 6:127997987-127998009 ATACCAATCTGGGGCATGGAAGG - Intronic
1015229428 6:130897095-130897117 ATACTATCCTGGGGCTACCACGG + Intronic
1015304765 6:131695623-131695645 AATCTAATCTGGGCCAGGCACGG + Intronic
1017032634 6:150237491-150237513 ATGCTACTCTGGGCCAGGCATGG - Intronic
1019280757 7:198838-198860 CTTCTCATCTGGGGAAGCCAGGG + Intronic
1020066973 7:5195749-5195771 ATACTCATCTAGGCCAGGCACGG + Intronic
1020386962 7:7617053-7617075 ATACAAAACTGGGCCAGACATGG + Intergenic
1020574890 7:9913675-9913697 AGACACAGCTGGGGCAGCCAAGG - Intergenic
1029664454 7:101986036-101986058 AGACAGATCTGGGGCAGCCCAGG - Intronic
1029992747 7:104976891-104976913 ATAACAATCTGGGCCAGGCACGG - Intergenic
1030049426 7:105524551-105524573 AAACCAATCTGGGCCAGGCATGG + Intergenic
1030456611 7:109782464-109782486 ATGGAAATCTGGGGAAGCCATGG + Intergenic
1031442739 7:121813598-121813620 ATACAAATATGGGCCAGGCATGG + Intergenic
1032245910 7:130212433-130212455 AAACTAATCTGGGCCAGGCGCGG + Intronic
1033322748 7:140355033-140355055 GGACTAATCTGGGTCAGGCATGG - Intronic
1033422690 7:141217475-141217497 GTCCTCACCTGGGGCAGCCAAGG - Intronic
1039089898 8:33816679-33816701 ATGCTACTATGGGGCAGTCATGG + Intergenic
1041675410 8:60533678-60533700 ATACTATTGTGGGCCAGGCATGG + Intronic
1042548148 8:69969540-69969562 ATACCTATCTGTGGCAGCTATGG - Intergenic
1043571538 8:81609078-81609100 ACCCTAATCTGGGCCAGGCATGG + Intergenic
1043578699 8:81687491-81687513 ATACTACTCTAGGCCAGGCAAGG + Intergenic
1044992121 8:97805390-97805412 ATACTGATCCGGATCAGCCAGGG - Exonic
1045322055 8:101089582-101089604 ATATAAATCTGTGGCAGCCATGG - Intergenic
1047192580 8:122691517-122691539 ACAGTAGTCTGGGGCTGCCAGGG - Intergenic
1049973206 9:839301-839323 ATACAAATATGGGTCAGGCACGG + Intergenic
1053082803 9:35191576-35191598 ATACTGATCTTGGGCAGTTAAGG - Intronic
1053248364 9:36553903-36553925 ATATTATTCTGGGCCAGGCATGG - Intergenic
1058629246 9:106969657-106969679 ATACTAATCTGGGAGATCCAGGG + Intronic
1185783583 X:2869930-2869952 ACACAGATCTGGGGCAGGCACGG - Intronic
1188592614 X:31857086-31857108 ATACCAATCTTGGCCAGGCATGG + Intronic
1192250269 X:69407349-69407371 ATGCTACTCTGGGGTAGCCAAGG + Intergenic
1197253401 X:124237663-124237685 ATACTGATAGGAGGCAGCCAGGG - Intronic
1197724104 X:129764671-129764693 ATACAAATCAGGGCCAGGCATGG + Intronic
1199741010 X:150736293-150736315 ATCGGAACCTGGGGCAGCCAAGG + Intronic
1201309858 Y:12587285-12587307 ATAGAAATGTGAGGCAGCCAAGG + Intergenic