ID: 1171970704

View in Genome Browser
Species Human (GRCh38)
Location 20:31563228-31563250
Sequence GAGGTACCCACTTGGATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171970704_1171970711 6 Left 1171970704 20:31563228-31563250 CCAGTCATCCAAGTGGGTACCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1171970711 20:31563257-31563279 AATCCTTGGAAAGGGGATCCAGG 0: 1
1: 0
2: 0
3: 18
4: 159
1171970704_1171970709 -2 Left 1171970704 20:31563228-31563250 CCAGTCATCCAAGTGGGTACCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1171970709 20:31563249-31563271 TCTCTGAAAATCCTTGGAAAGGG 0: 1
1: 0
2: 2
3: 35
4: 299
1171970704_1171970714 15 Left 1171970704 20:31563228-31563250 CCAGTCATCCAAGTGGGTACCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1171970714 20:31563266-31563288 AAAGGGGATCCAGGACATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 220
1171970704_1171970713 14 Left 1171970704 20:31563228-31563250 CCAGTCATCCAAGTGGGTACCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1171970713 20:31563265-31563287 GAAAGGGGATCCAGGACATGAGG 0: 1
1: 0
2: 0
3: 15
4: 258
1171970704_1171970706 -8 Left 1171970704 20:31563228-31563250 CCAGTCATCCAAGTGGGTACCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1171970706 20:31563243-31563265 GGTACCTCTCTGAAAATCCTTGG No data
1171970704_1171970708 -3 Left 1171970704 20:31563228-31563250 CCAGTCATCCAAGTGGGTACCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1171970708 20:31563248-31563270 CTCTCTGAAAATCCTTGGAAAGG 0: 1
1: 0
2: 4
3: 23
4: 191
1171970704_1171970710 -1 Left 1171970704 20:31563228-31563250 CCAGTCATCCAAGTGGGTACCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1171970710 20:31563250-31563272 CTCTGAAAATCCTTGGAAAGGGG 0: 1
1: 0
2: 0
3: 27
4: 228
1171970704_1171970715 16 Left 1171970704 20:31563228-31563250 CCAGTCATCCAAGTGGGTACCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1171970715 20:31563267-31563289 AAGGGGATCCAGGACATGAGGGG 0: 1
1: 0
2: 0
3: 19
4: 207
1171970704_1171970717 30 Left 1171970704 20:31563228-31563250 CCAGTCATCCAAGTGGGTACCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1171970717 20:31563281-31563303 CATGAGGGGACCCTGTCCCATGG 0: 1
1: 0
2: 5
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171970704 Original CRISPR GAGGTACCCACTTGGATGAC TGG (reversed) Intronic
900217496 1:1489595-1489617 GAGGTCCCCAGTAGGGTGACCGG + Intronic
902943025 1:19814234-19814256 GAATTACACGCTTGGATGACAGG - Exonic
912511372 1:110192411-110192433 GAGGTTCCCACCTGGGTGCCTGG + Intronic
914263804 1:146020648-146020670 AGGGTACCCACTAGGATTACTGG - Intronic
919463667 1:197908028-197908050 GTGCTTCCCACTTGGAAGACTGG + Intergenic
920117487 1:203630736-203630758 CAAATACCCACTGGGATGACAGG - Intronic
923322362 1:232847402-232847424 GTGGTACACACTTGGAAGAGGGG + Intergenic
1067932430 10:50576163-50576185 GAGGTACCCACTGAGAAGACAGG + Intronic
1070618502 10:77988043-77988065 GAGGTAGCCCCTTGGCTGCCTGG - Intronic
1070809482 10:79290449-79290471 GAGGGAGCCACTGGGCTGACCGG + Intronic
1071112388 10:82175024-82175046 GAGATTCTAACTTGGATGACTGG - Intronic
1073104997 10:101027448-101027470 GAGGTACTCACTGGGAGGAAGGG - Intronic
1073764097 10:106662968-106662990 GACGTACCCAGTTGGCTGAGTGG + Intronic
1076119247 10:127922558-127922580 TAAGTGCCCACTTGGATGACAGG - Intronic
1078624287 11:12939812-12939834 GAGAAGCCCACTGGGATGACTGG - Intronic
1081251335 11:40838436-40838458 GTGGTAACCGCTTGGATGAATGG - Intronic
1081783380 11:45729072-45729094 GTGGTGCCCCCTTGGAGGACTGG - Intergenic
1091887462 12:4027105-4027127 GAGGTTCCCAGAGGGATGACTGG + Intergenic
1094641182 12:32276907-32276929 GAGGTACCCTCTTGAATAAGAGG - Intronic
1096551075 12:52371982-52372004 GGGCAAGCCACTTGGATGACAGG - Intergenic
1097785966 12:63759017-63759039 CAGGTACCCACTAGCATGCCCGG - Intergenic
1109241150 13:59890168-59890190 GAGATACCCACGTGGACTACTGG + Intronic
1111172086 13:84540986-84541008 GAGGTACCCACTTCTCTGACAGG + Intergenic
1118645633 14:67836216-67836238 GAGGGGCCCACTTACATGACTGG + Intronic
1122697657 14:103564306-103564328 GAGCTAGCCACTTGGGTGTCTGG - Intronic
1124684614 15:31771508-31771530 GAGGAACCCACTGGCATCACTGG - Intronic
1129373751 15:75114614-75114636 AAGGTAGTCACCTGGATGACTGG + Intronic
1131116603 15:89799886-89799908 GTGGTTCCCACTTGGGTGACAGG - Intronic
1131577515 15:93606449-93606471 GAGGTACCCACCTGGATACCTGG - Intergenic
1135035295 16:19072095-19072117 GAAGCACCCACCTGAATGACTGG - Exonic
1136517075 16:30774673-30774695 GAGGTACCCTCTTGGCAGATGGG + Exonic
1139700001 16:68702454-68702476 GGGGTTCACTCTTGGATGACTGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1148245160 17:46025531-46025553 GAGGGTCCCAGTTGGATGAGTGG - Exonic
1151163606 17:72185921-72185943 GAGGGACCCACTGCGGTGACCGG + Intergenic
1151872885 17:76848516-76848538 GACGTACCCCCTTTGATGTCTGG - Intergenic
1159033996 18:63259625-63259647 AAGGTAACCACTGGGATGGCTGG - Intronic
1159879693 18:73846558-73846580 CAGGCACATACTTGGATGACTGG - Intergenic
933869179 2:86549727-86549749 GAGGCACCCACTTCGCAGACGGG + Intronic
935213631 2:100958747-100958769 GAGATATCCACTTTGAAGACAGG + Intronic
948788648 2:240365907-240365929 GAGGTGGCGTCTTGGATGACAGG - Intergenic
1171970704 20:31563228-31563250 GAGGTACCCACTTGGATGACTGG - Intronic
1174888571 20:54363927-54363949 GAGGGGCCCATTTAGATGACTGG - Intergenic
1179665613 21:42910180-42910202 CAGGTACCCACTAGCATGCCTGG - Intronic
1183979497 22:41531319-41531341 CACCTGCCCACTTGGATGACAGG + Intronic
958573813 3:95921481-95921503 GAGGGACCCATTCAGATGACTGG + Intergenic
966388405 3:179426553-179426575 GACTTCCCCACTTGGATGTCTGG + Intronic
971503164 4:27338384-27338406 AAGGTTCCCACTTAAATGACAGG - Intergenic
974120702 4:57634718-57634740 GAGGTAGCATCTTGAATGACAGG - Intergenic
975415193 4:74097886-74097908 GCAGTACCCACTTGGGTGCCAGG - Intronic
997213068 5:132089042-132089064 GAGGTATCCAACTGGATCACCGG + Intergenic
999635931 5:153622314-153622336 GAGGTACTCGTTTGGATTACTGG - Intronic
1006399464 6:33808217-33808239 GAGGAACCCACCTGGAGAACAGG - Intergenic
1010325073 6:74554933-74554955 GAGGTCCCCATTTGCAGGACTGG + Intergenic
1014981353 6:127949812-127949834 GAGGCACCAACTTGGATAATAGG + Intergenic
1018100120 6:160430372-160430394 GAGCTCCCCACGTGGAGGACTGG - Intronic
1023870644 7:44261395-44261417 GAGGTACCTTCATAGATGACAGG - Intronic
1024322560 7:48085584-48085606 GAGGTAACCACTTAGCTGAAGGG - Intergenic
1027178709 7:75922198-75922220 AAGGTAGGCACTTGGATGAATGG + Intronic
1027224095 7:76233338-76233360 GAGGGACCCAACTTGATGACAGG + Intronic
1031633814 7:124077728-124077750 AAGGTAGCCACTAGGATGTCAGG + Intergenic
1033580663 7:142730847-142730869 GAAGTCAACACTTGGATGACAGG + Intergenic
1045560531 8:103257604-103257626 GAAGTGGCCACCTGGATGACAGG - Intergenic
1050685838 9:8168458-8168480 GAGTTATCCAGTTGGAGGACTGG + Intergenic
1051529573 9:18085194-18085216 GAGGTTCCCACTTGAATCACAGG - Intergenic
1059245454 9:112845824-112845846 GAGTTTCCCTCTTGGATGAGTGG + Intronic
1060828934 9:126701927-126701949 GACGTCTCCACTTGGATGCCTGG - Intergenic
1189666759 X:43363954-43363976 GAGGTATTCACTGGGTTGACAGG - Intergenic
1190495295 X:51022858-51022880 GAGGTACCCACTTACATGTTTGG - Intergenic
1193251156 X:79291883-79291905 CAGGTACACACTTGCATGAGAGG + Intergenic
1197044432 X:121978445-121978467 GATGTACCCACTTTTATGGCTGG - Intergenic
1199985762 X:152949035-152949057 GAGATCCCAAATTGGATGACAGG + Intronic