ID: 1171976352

View in Genome Browser
Species Human (GRCh38)
Location 20:31597132-31597154
Sequence GTGCACTCCCTTTTATCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171976347_1171976352 26 Left 1171976347 20:31597083-31597105 CCCTGGAAGGCAGAGAAGGAGGT No data
Right 1171976352 20:31597132-31597154 GTGCACTCCCTTTTATCACCAGG No data
1171976348_1171976352 25 Left 1171976348 20:31597084-31597106 CCTGGAAGGCAGAGAAGGAGGTG No data
Right 1171976352 20:31597132-31597154 GTGCACTCCCTTTTATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171976352 Original CRISPR GTGCACTCCCTTTTATCACC AGG Intergenic
No off target data available for this crispr