ID: 1171980268

View in Genome Browser
Species Human (GRCh38)
Location 20:31623121-31623143
Sequence CCTGTTAGCCAGACAGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171980263_1171980268 0 Left 1171980263 20:31623098-31623120 CCAGAGAACCAGGAAAACACGCC No data
Right 1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG No data
1171980260_1171980268 28 Left 1171980260 20:31623070-31623092 CCTTCAAAAGAAAAGTTTAATAT No data
Right 1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG No data
1171980264_1171980268 -8 Left 1171980264 20:31623106-31623128 CCAGGAAAACACGCCCCTGTTAG No data
Right 1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171980268 Original CRISPR CCTGTTAGCCAGACAGTGTG AGG Intergenic
No off target data available for this crispr