ID: 1171981408

View in Genome Browser
Species Human (GRCh38)
Location 20:31631872-31631894
Sequence TTGGCTCCTGCACATGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171981408_1171981413 6 Left 1171981408 20:31631872-31631894 CCATGCCCATGTGCAGGAGCCAA No data
Right 1171981413 20:31631901-31631923 CTCAGAGAAGACAGAGGCCCTGG No data
1171981408_1171981416 23 Left 1171981408 20:31631872-31631894 CCATGCCCATGTGCAGGAGCCAA No data
Right 1171981416 20:31631918-31631940 CCCTGGCCTCCAGGATGTGAAGG No data
1171981408_1171981414 14 Left 1171981408 20:31631872-31631894 CCATGCCCATGTGCAGGAGCCAA No data
Right 1171981414 20:31631909-31631931 AGACAGAGGCCCTGGCCTCCAGG No data
1171981408_1171981412 0 Left 1171981408 20:31631872-31631894 CCATGCCCATGTGCAGGAGCCAA No data
Right 1171981412 20:31631895-31631917 TTGTGTCTCAGAGAAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171981408 Original CRISPR TTGGCTCCTGCACATGGGCA TGG (reversed) Intergenic
No off target data available for this crispr