ID: 1171982213

View in Genome Browser
Species Human (GRCh38)
Location 20:31636169-31636191
Sequence ACAGAATTGTAAGCCCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171982208_1171982213 -5 Left 1171982208 20:31636151-31636173 CCTTTTCCTCTGCCTAGAACAGA No data
Right 1171982213 20:31636169-31636191 ACAGAATTGTAAGCCCTGTGGGG No data
1171982207_1171982213 15 Left 1171982207 20:31636131-31636153 CCTCTGGGTCTTTGCACAGGCCT No data
Right 1171982213 20:31636169-31636191 ACAGAATTGTAAGCCCTGTGGGG No data
1171982205_1171982213 19 Left 1171982205 20:31636127-31636149 CCTGCCTCTGGGTCTTTGCACAG No data
Right 1171982213 20:31636169-31636191 ACAGAATTGTAAGCCCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171982213 Original CRISPR ACAGAATTGTAAGCCCTGTG GGG Intergenic
No off target data available for this crispr