ID: 1171984297

View in Genome Browser
Species Human (GRCh38)
Location 20:31648789-31648811
Sequence AATGGAGTTACTAGGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171984297_1171984299 -8 Left 1171984297 20:31648789-31648811 CCATCACACCTAGTAACTCCATT No data
Right 1171984299 20:31648804-31648826 ACTCCATTGTGCTCAGTCCCTGG No data
1171984297_1171984302 -3 Left 1171984297 20:31648789-31648811 CCATCACACCTAGTAACTCCATT No data
Right 1171984302 20:31648809-31648831 ATTGTGCTCAGTCCCTGGTTGGG No data
1171984297_1171984306 18 Left 1171984297 20:31648789-31648811 CCATCACACCTAGTAACTCCATT No data
Right 1171984306 20:31648830-31648852 GGAGCGGCCCAGAAAGATCATGG No data
1171984297_1171984303 2 Left 1171984297 20:31648789-31648811 CCATCACACCTAGTAACTCCATT No data
Right 1171984303 20:31648814-31648836 GCTCAGTCCCTGGTTGGGAGCGG No data
1171984297_1171984301 -4 Left 1171984297 20:31648789-31648811 CCATCACACCTAGTAACTCCATT No data
Right 1171984301 20:31648808-31648830 CATTGTGCTCAGTCCCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171984297 Original CRISPR AATGGAGTTACTAGGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr