ID: 1171984298

View in Genome Browser
Species Human (GRCh38)
Location 20:31648797-31648819
Sequence CTGAGCACAATGGAGTTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171984298_1171984303 -6 Left 1171984298 20:31648797-31648819 CCTAGTAACTCCATTGTGCTCAG No data
Right 1171984303 20:31648814-31648836 GCTCAGTCCCTGGTTGGGAGCGG No data
1171984298_1171984306 10 Left 1171984298 20:31648797-31648819 CCTAGTAACTCCATTGTGCTCAG No data
Right 1171984306 20:31648830-31648852 GGAGCGGCCCAGAAAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171984298 Original CRISPR CTGAGCACAATGGAGTTACT AGG (reversed) Intergenic
No off target data available for this crispr