ID: 1171984300

View in Genome Browser
Species Human (GRCh38)
Location 20:31648807-31648829
Sequence CAACCAGGGACTGAGCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171984300_1171984310 24 Left 1171984300 20:31648807-31648829 CCATTGTGCTCAGTCCCTGGTTG No data
Right 1171984310 20:31648854-31648876 CTCAGCATGAACACTACAGCAGG No data
1171984300_1171984306 0 Left 1171984300 20:31648807-31648829 CCATTGTGCTCAGTCCCTGGTTG No data
Right 1171984306 20:31648830-31648852 GGAGCGGCCCAGAAAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171984300 Original CRISPR CAACCAGGGACTGAGCACAA TGG (reversed) Intergenic
No off target data available for this crispr