ID: 1171984306

View in Genome Browser
Species Human (GRCh38)
Location 20:31648830-31648852
Sequence GGAGCGGCCCAGAAAGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171984300_1171984306 0 Left 1171984300 20:31648807-31648829 CCATTGTGCTCAGTCCCTGGTTG No data
Right 1171984306 20:31648830-31648852 GGAGCGGCCCAGAAAGATCATGG No data
1171984297_1171984306 18 Left 1171984297 20:31648789-31648811 CCATCACACCTAGTAACTCCATT No data
Right 1171984306 20:31648830-31648852 GGAGCGGCCCAGAAAGATCATGG No data
1171984298_1171984306 10 Left 1171984298 20:31648797-31648819 CCTAGTAACTCCATTGTGCTCAG No data
Right 1171984306 20:31648830-31648852 GGAGCGGCCCAGAAAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171984306 Original CRISPR GGAGCGGCCCAGAAAGATCA TGG Intergenic
No off target data available for this crispr