ID: 1171988711

View in Genome Browser
Species Human (GRCh38)
Location 20:31678962-31678984
Sequence AGAAGGAAATGCAACACCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171988711_1171988715 0 Left 1171988711 20:31678962-31678984 CCCACGGTGTTGCATTTCCTTCT 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1171988715 20:31678985-31679007 ATTCTGTGATGTGATGGAACTGG 0: 1
1: 0
2: 1
3: 18
4: 198
1171988711_1171988716 1 Left 1171988711 20:31678962-31678984 CCCACGGTGTTGCATTTCCTTCT 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1171988716 20:31678986-31679008 TTCTGTGATGTGATGGAACTGGG 0: 1
1: 1
2: 0
3: 14
4: 202
1171988711_1171988714 -6 Left 1171988711 20:31678962-31678984 CCCACGGTGTTGCATTTCCTTCT 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1171988714 20:31678979-31679001 CCTTCTATTCTGTGATGTGATGG 0: 1
1: 0
2: 2
3: 17
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171988711 Original CRISPR AGAAGGAAATGCAACACCGT GGG (reversed) Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
902087216 1:13872853-13872875 AGAAGGAAATGAAACATCACAGG + Intergenic
905303832 1:37004142-37004164 AGAAGAAAATGCAACAGGGCAGG + Intronic
907485998 1:54778535-54778557 GGAAAGAAATGCAACACAGTGGG + Intergenic
907618490 1:55950446-55950468 AGAAGGAAATCAAACAAGGTGGG + Intergenic
910238561 1:85061861-85061883 AGAAGGAAATGTAACCCATTAGG + Intronic
910723022 1:90308481-90308503 AGAAGCAAATGCATCCCTGTGGG - Intergenic
914317603 1:146529042-146529064 AGAAGGCAATGACACACCTTAGG + Intergenic
914496752 1:148204318-148204340 AGAAGGCAATGACACACCTTAGG - Intergenic
917441484 1:175072797-175072819 AGAAGGACAGGCAACACCAAGGG + Intronic
918123992 1:181566492-181566514 AGAAGGAAATGCAGGACCATTGG + Intronic
920328651 1:205187783-205187805 GGAAGGAAATGCAGCTCAGTTGG + Exonic
922108671 1:222535667-222535689 AGAAGGTGATGCAACAACGATGG - Intronic
1064830670 10:19462415-19462437 AGAAGGAGATGCAAAATTGTGGG - Intronic
1067035606 10:42914133-42914155 AGAAGGAAATTGAACACAGAAGG + Intergenic
1067054673 10:43043772-43043794 AGATGGAAATGCCACCCTGTGGG + Intergenic
1069272341 10:66544885-66544907 AGAAGGACAGAGAACACCGTTGG - Intronic
1069399148 10:68023388-68023410 AGAAGGAAATTCTACAACATGGG + Intronic
1071307509 10:84312112-84312134 AGAAAGAAAAGCAAAACCGGAGG + Intergenic
1072435649 10:95412869-95412891 AGAAGGATATCCAAGGCCGTGGG + Intronic
1072784787 10:98272328-98272350 TGACAGACATGCAACACCGTCGG + Intergenic
1077579403 11:3407289-3407311 ACAAGTAAAGGCAACACCCTGGG - Intergenic
1079458492 11:20658450-20658472 AGAAGGAAATGCTCCTCTGTTGG - Exonic
1081981192 11:47268365-47268387 AGGAGGAAAAGGAACACCATGGG - Intronic
1083017533 11:59470841-59470863 TGAAGCAAATGCAACACTGCTGG + Intergenic
1084011030 11:66348445-66348467 AGAAGGAAAGAAAACACCTTTGG - Intronic
1085087083 11:73675810-73675832 AGAATCAAATGCAACAGTGTAGG + Exonic
1090480901 11:127067279-127067301 AGAAGGAAATCCAGCTCCTTTGG - Intergenic
1093651631 12:21652612-21652634 AGAAGGAAATGCAAAAGGATAGG + Intronic
1093651642 12:21652750-21652772 AGAAGGAAATGCAAAAGGATAGG + Intronic
1093803319 12:23400502-23400524 AGAAGGCAGTGTAACACAGTAGG - Intergenic
1094161816 12:27398713-27398735 AGAAGTAAATGCAACAGGCTAGG + Intronic
1094343526 12:29440266-29440288 AGAAGGAAATAGAAAACAGTAGG + Intronic
1096558180 12:52416985-52417007 TGATTGAAATGCAACACTGTGGG + Intergenic
1097385122 12:58941877-58941899 AGAAGGAAATGGAAAGCCCTTGG + Intergenic
1098224364 12:68306754-68306776 AAAAGGAAACGCAACCCCTTTGG + Intronic
1102464858 12:113123276-113123298 ACAAGGAAATGAGACACCATGGG - Intronic
1102866171 12:116376887-116376909 AGAAAGAAATGGAATACTGTTGG + Intergenic
1102870396 12:116409722-116409744 GGAAGGATATGCAACAGCATGGG - Intergenic
1104872187 12:132007851-132007873 GGAAAGAAATGGAACACAGTGGG + Intronic
1105675869 13:22671293-22671315 AGTATGAAATGAAACATCGTTGG + Intergenic
1107972099 13:45653292-45653314 ACAAACAAATGCAACACTGTTGG - Intergenic
1108254449 13:48596923-48596945 ATAAGGAAAGGCTACTCCGTAGG - Intergenic
1111892229 13:94097691-94097713 AAAGAGAAATGCAACACAGTTGG + Intronic
1112300671 13:98226918-98226940 AGAAAGAAATGCAACATGATTGG - Intronic
1112960154 13:105114387-105114409 AGAAAGAAATGCAACATCTGAGG + Intergenic
1114921067 14:27329688-27329710 AGAAGCAAATGAACCACTGTGGG + Intergenic
1115948241 14:38689387-38689409 TGAAGGAAAGGCAACACAGCAGG + Intergenic
1116283769 14:42945790-42945812 AGAGGGAAATGGGACACCCTAGG - Intergenic
1118972082 14:70645352-70645374 GGAAGGAAATACACCACAGTGGG - Intronic
1119171071 14:72536826-72536848 AGAGAGAAAGGCAACACCGTGGG - Intronic
1119694021 14:76698398-76698420 AGAAGGGAAGGGAACACCGAGGG - Intergenic
1122154938 14:99744704-99744726 AAATGCAAATGCAACTCCGTGGG - Intronic
1123109855 14:105861276-105861298 AGAAGCAAATGCAGCAGCGGCGG + Intergenic
1124361508 15:29039878-29039900 AGAATGAAAAGCAACCCCATCGG + Intronic
1126305065 15:47246481-47246503 AGAAAGGAATGCAACCCTGTTGG - Intronic
1131612528 15:93980068-93980090 AGAATGAATTGCAACACTGATGG - Intergenic
1131717307 15:95127125-95127147 AGAAGGAAATGCTGCACCAATGG - Intergenic
1134899936 16:17928434-17928456 AGAAGGAAACACAAAACCATGGG - Intergenic
1140802391 16:78500364-78500386 AGAAAGAAATGCAAAAATGTTGG - Intronic
1141196113 16:81862536-81862558 AAAAGGAAAAGCAACACCAGTGG - Intronic
1141292982 16:82737542-82737564 AGTATGAAATGCAAGACCGTTGG - Intronic
1142730435 17:1851220-1851242 AGATGGAAATACAACACGGACGG - Intronic
1146662897 17:34676481-34676503 AGGAGGAAATGCGAGACCATGGG - Intergenic
1147812153 17:43179693-43179715 AGAAACAAATGCAACACCATGGG - Intronic
1150850226 17:68697074-68697096 GGAGAGAAATGCCACACCGTAGG + Intergenic
1151206266 17:72509954-72509976 AGAAGGAAATTAAACTCGGTGGG - Intergenic
1156848615 18:41699679-41699701 AGAAGGAAACTCAAAACCATTGG - Intergenic
1160105501 18:75970614-75970636 AGAAGTAAATGCCACTCAGTGGG - Intergenic
1160225298 18:77007177-77007199 AGAAGGAATTGCAAGGCCGGAGG - Intronic
1161442893 19:4302457-4302479 AGAAGCAGATGCAACACCCAGGG + Intergenic
1164342213 19:24415084-24415106 AAAAGAAAATTCAACACCATGGG - Intergenic
925997960 2:9307232-9307254 AACAGGAAATGCAAAACCCTGGG - Intronic
926381263 2:12292424-12292446 AGAATGCAATCCAACACTGTTGG - Intergenic
927408433 2:22798117-22798139 AGAAGGAAATGGAACCCCAGAGG - Intergenic
928092272 2:28382236-28382258 AGAAAGGAATGTAACACTGTGGG + Intergenic
929504328 2:42516584-42516606 AGAAGGAAATGGCTCACCGGCGG + Intronic
929581376 2:43083499-43083521 AGAAGGAAATGCGCCACAGATGG + Intergenic
930166804 2:48211111-48211133 AGAAGGATATGCAGCACCAGGGG - Intergenic
931595629 2:63939442-63939464 AGAAATAAATGCAACAATGTAGG + Intronic
933387623 2:81631280-81631302 AGCAGCAAATGCAACAACATGGG + Intergenic
933949990 2:87320801-87320823 GGAAGGAAAGGCAAAACTGTTGG + Intergenic
936330200 2:111540796-111540818 GGAAGGAAAGGCAAAACTGTTGG - Intergenic
938272185 2:129982802-129982824 AGAATCAAATGCAACAGTGTAGG - Intergenic
938443826 2:131361026-131361048 AGAATCAAATGCAACAGTGTAGG + Intergenic
940517043 2:154696535-154696557 AGAAGGGAAAGTGACACCGTGGG - Intergenic
941245210 2:163087534-163087556 AGAAGGAAATGCTACAGAGGTGG - Intergenic
941348055 2:164394472-164394494 AGAAGAAAATGAGACACCTTGGG - Intergenic
943446933 2:187997614-187997636 AGAAGGAAAAGCAAAACATTTGG + Intergenic
945859581 2:215105341-215105363 AAAAGGACATGCATCAACGTGGG + Intronic
946641706 2:221790799-221790821 AGAAGGAAAGGCAAGACAGTTGG + Intergenic
1171988711 20:31678962-31678984 AGAAGGAAATGCAACACCGTGGG - Intronic
1173942852 20:46926807-46926829 AAAAATAAATGCAACACCTTGGG + Intronic
1173985039 20:47254627-47254649 AGAAGGAAATGGAAAATCGCTGG + Intronic
1174722230 20:52825031-52825053 AGAAGGAACTGGAACAAAGTAGG + Intergenic
1174724138 20:52843673-52843695 AGAAGGCAATGCAATGCCGTCGG - Intergenic
1176016299 20:62935095-62935117 AGAAGGAGGTGCAACAACGAGGG - Intronic
1177358057 21:20033784-20033806 ATAAGTAAATGCTACACCTTAGG + Intergenic
1177620119 21:23579589-23579611 AGAAGGATATGCATCACTATTGG + Intergenic
1177699460 21:24617858-24617880 AGAAGGTAATGCAAAATCTTAGG - Intergenic
1177754316 21:25326853-25326875 AGAAGGAAATGAAAAACATTTGG - Intergenic
1182311245 22:29409379-29409401 AGAAGGAAATGAAAGAGCCTTGG - Intronic
955509542 3:59665618-59665640 AGAAGCAAAGGCACCACAGTTGG + Intergenic
955510779 3:59678286-59678308 AGAAAGAAATGCAACTCCACCGG + Intergenic
955602368 3:60660223-60660245 GGAAGGAAATGCAACAACAATGG + Intronic
956865666 3:73366447-73366469 AGCAGCAAATGCAAAACCTTGGG - Intergenic
957052380 3:75420612-75420634 ACAAGTAAATGCAACCCCCTGGG - Intergenic
958917091 3:100061763-100061785 AGAAGGTAATGCAATACCCAAGG + Intronic
959146295 3:102549601-102549623 AGAAGGAAATGAATGACTGTGGG - Intergenic
962333320 3:134500560-134500582 TGGAGAAAAGGCAACACCGTTGG - Intronic
964444774 3:156747540-156747562 ACAAGGAAATCCAACACTGAGGG - Intergenic
964740548 3:159960862-159960884 ATAAGCAAATGAAACACCTTTGG + Intergenic
966342890 3:178945215-178945237 AGAAGGAAATGCAACACAGGTGG - Intergenic
969060502 4:4430312-4430334 AGAAAGAAATACAACACTGTTGG - Intronic
969304070 4:6315272-6315294 AGAAGGAATTGCTACTCCATAGG - Intergenic
970821746 4:20224452-20224474 AGAAGGAAAAGCATCACAGAAGG - Intergenic
974183055 4:58408184-58408206 AGGAGGAAATGCAATACCTTTGG + Intergenic
976477207 4:85497938-85497960 AGAAGGAAATTGAACACCGAGGG - Intronic
976616777 4:87086257-87086279 AGAAGTAAATGCAACAGTGCAGG + Intronic
977710030 4:100114183-100114205 AGAAAGAAATGCTACACAGAGGG + Intergenic
979485859 4:121269677-121269699 AGAAGGAAATGTAATCCCATGGG - Intergenic
985848340 5:2370779-2370801 AGATGCAAATGCAACAACCTTGG + Intergenic
986169913 5:5306982-5307004 ATAAGGAAATGCAATGCCTTGGG + Intronic
986329257 5:6705331-6705353 AGAGGGAAGTGCAACCTCGTGGG - Intergenic
993285805 5:85994436-85994458 AGAATCAAATTCAACATCGTGGG + Intergenic
995663538 5:114513471-114513493 AAAAGGAAATGCAATATCCTAGG - Intergenic
1000451236 5:161390441-161390463 ATAACTAAATGCAACACCCTAGG + Intronic
1003171024 6:3722282-3722304 AGAGGGAAATGCAAAACCAAAGG + Intergenic
1004370784 6:15050407-15050429 AGAAGGAAACGCGATACCGCAGG + Intergenic
1004460037 6:15827196-15827218 AGAAAGAAAAGCAACTCCCTAGG - Intergenic
1005179290 6:23085681-23085703 AGAGGGAAATGCAACATGTTTGG - Intergenic
1007995915 6:46307771-46307793 TGAATGAACTGCAACACCTTGGG + Intronic
1014637545 6:123866728-123866750 AGAAGCAAATGTAAAACTGTGGG - Intronic
1015841897 6:137486384-137486406 AGAAAGAAATTCAACACAGAAGG + Intergenic
1018080950 6:160258938-160258960 AGAAGGACATGCACCCCCGCTGG - Exonic
1020531440 7:9342321-9342343 AGAAGGAAATGCAACCTTGCTGG - Intergenic
1020547848 7:9556115-9556137 AGAAGAACATGCAACAGCGCAGG + Intergenic
1024187333 7:46964156-46964178 AGAAAGAAATGGCACACAGTGGG + Intergenic
1028715916 7:93968212-93968234 AGAAAGAATTGCAATAGCGTTGG + Intronic
1029172423 7:98640441-98640463 AGACGGAAATAGAACCCCGTAGG - Intergenic
1033613291 7:142986466-142986488 AGAAGTAAAAGCAACAACCTGGG - Intergenic
1036664182 8:10728416-10728438 AGAAGGAAATGTCACACAGGTGG + Intronic
1038024817 8:23578912-23578934 AGAAGGAAATGCAATATTGGTGG + Intergenic
1041617995 8:59930894-59930916 AGAAAGAAATGCAACATGGAGGG - Intergenic
1042584223 8:70317439-70317461 AGAGGGAAATGCCACAGTGTTGG - Intronic
1044108427 8:88240385-88240407 AGAAGGAAATTCAACACATTTGG + Intronic
1046868431 8:119176768-119176790 AGAAGGAGATGGAACACTGGTGG - Intronic
1047370175 8:124249720-124249742 AGAAAGAAATGAATCACCTTGGG + Intergenic
1050325839 9:4496258-4496280 AGGAGGAAGTTCAACAGCGTTGG + Intronic
1051717825 9:20003364-20003386 AGAGAGAAATGCACCACTGTAGG + Intergenic
1055274322 9:74597106-74597128 TGAAGGAAATGCAAATCCTTGGG - Intronic
1057249838 9:93492413-93492435 AGACAGAAATGCAACACCACAGG - Intronic
1057574111 9:96227518-96227540 AGGAGTAAATGCAACAACATGGG + Intergenic
1058148235 9:101435155-101435177 ATGAGGAAATGCAACAGGGTTGG - Intronic
1059060933 9:111035084-111035106 AGAAAGAACTGCAACACAGGGGG - Intronic
1185974359 X:4702924-4702946 AGAAATAAATGCATCACCCTGGG - Intergenic
1194929994 X:99876049-99876071 AGAGGGAAATGCAATTCAGTAGG + Intergenic
1196118264 X:112020479-112020501 AGAAGGAAATGTAATATCCTAGG + Intronic
1197838437 X:130719722-130719744 GGAAAGAAATGCAATACAGTGGG + Intronic
1198056325 X:132999320-132999342 AGCAGGAAATGCTGCACCATTGG + Intergenic
1200866611 Y:8050769-8050791 AGAAGGAAATCCAAGACATTTGG - Intergenic