ID: 1171988985

View in Genome Browser
Species Human (GRCh38)
Location 20:31681117-31681139
Sequence CCTACCAGGCCCCACACAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171988985_1171988994 19 Left 1171988985 20:31681117-31681139 CCGATTGTGTGGGGCCTGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 149
Right 1171988994 20:31681159-31681181 TGTCCTGGGAAAGCACTGTAGGG 0: 1
1: 0
2: 4
3: 26
4: 181
1171988985_1171988996 30 Left 1171988985 20:31681117-31681139 CCGATTGTGTGGGGCCTGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 149
Right 1171988996 20:31681170-31681192 AGCACTGTAGGGTTTTGAGCAGG 0: 1
1: 1
2: 7
3: 54
4: 347
1171988985_1171988991 4 Left 1171988985 20:31681117-31681139 CCGATTGTGTGGGGCCTGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 149
Right 1171988991 20:31681144-31681166 TTAAAGACTTGGGCTTGTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 186
1171988985_1171988992 5 Left 1171988985 20:31681117-31681139 CCGATTGTGTGGGGCCTGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 149
Right 1171988992 20:31681145-31681167 TAAAGACTTGGGCTTGTCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 182
1171988985_1171988988 -7 Left 1171988985 20:31681117-31681139 CCGATTGTGTGGGGCCTGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 149
Right 1171988988 20:31681133-31681155 TGGTAGGCCATTTAAAGACTTGG 0: 1
1: 0
2: 0
3: 7
4: 109
1171988985_1171988989 -6 Left 1171988985 20:31681117-31681139 CCGATTGTGTGGGGCCTGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 149
Right 1171988989 20:31681134-31681156 GGTAGGCCATTTAAAGACTTGGG 0: 1
1: 0
2: 3
3: 9
4: 116
1171988985_1171988993 18 Left 1171988985 20:31681117-31681139 CCGATTGTGTGGGGCCTGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 149
Right 1171988993 20:31681158-31681180 TTGTCCTGGGAAAGCACTGTAGG 0: 1
1: 0
2: 2
3: 18
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171988985 Original CRISPR CCTACCAGGCCCCACACAAT CGG (reversed) Intronic
900428860 1:2592640-2592662 CCTGCCAGGCCCCACCTTATAGG + Exonic
900585189 1:3429226-3429248 CAAACCAAGCCCCACAGAATGGG - Intronic
903235030 1:21944594-21944616 CCTCCCAGGCCCCTCCCAACAGG - Intergenic
903532615 1:24043362-24043384 CCCACAAGGCCCTACACAAATGG + Intergenic
903532675 1:24043828-24043850 CCCACAAGGCCCTACACAAATGG - Intergenic
910632077 1:89365676-89365698 CATAGCATGCACCACACAATAGG - Intronic
914938243 1:151999574-151999596 CCTGTCTGCCCCCACACAATGGG - Intergenic
916106396 1:161435716-161435738 CTTGACAGGCCCCACACCATTGG + Intergenic
916191628 1:162184672-162184694 AATACCATGTCCCACACAATGGG + Intronic
917633235 1:176910391-176910413 CCTAACAAACCCCACTCAATTGG + Intronic
919940253 1:202281495-202281517 CCTGCCAGTCCCCACACAGTGGG + Intronic
922077651 1:222263833-222263855 CCTCCAAGGCCCCACGCTATAGG + Intergenic
922501345 1:226098974-226098996 CCCACCAGGCCCCACCTCATAGG - Intergenic
1070462381 10:76682824-76682846 CTAACCAGGCCCCACCCAATTGG - Intergenic
1074460350 10:113631040-113631062 CCTCCCAGGCTCCAGCCAATCGG - Intronic
1075023100 10:118965679-118965701 CCTGCCAGGCACCCCACAATGGG + Intergenic
1075568176 10:123519896-123519918 CCAACCAGGCCCTTCACATTGGG + Intergenic
1077298792 11:1837959-1837981 CCTCCCAGTCCCCACACATCTGG + Intergenic
1077667406 11:4125475-4125497 CCTACAAGGTCCTACACAACTGG + Intronic
1080855220 11:36106158-36106180 TCTACCAAGTCCCACACCATAGG - Intronic
1084684972 11:70688047-70688069 CCTGCCTGGCCCCACAGAAAAGG + Intronic
1085690554 11:78660502-78660524 CCTACCAGACCCCGGAGAATGGG - Intronic
1085976490 11:81661389-81661411 CCCACCAGGCCCCTCAACATTGG + Intergenic
1086393524 11:86390423-86390445 CATATAAGGCCCCTCACAATTGG - Intronic
1086798784 11:91144548-91144570 CCTACCAGTTCCCCCACATTTGG + Intergenic
1090420875 11:126574032-126574054 CCTTACAGGCCCCAGACAAGGGG + Intronic
1093059694 12:14589562-14589584 CCTACCAGGCTCCACAGAACAGG - Intergenic
1097953558 12:65460208-65460230 CCTCCCAGGCCCCAGCCAACTGG - Intronic
1098733244 12:74065228-74065250 CTTGACAGGCCCCACACCATTGG - Intergenic
1100413800 12:94351176-94351198 CCTACCATTTCTCACACAATGGG - Intronic
1101543016 12:105682248-105682270 CTCAACAGGCCCCACACAATTGG - Intergenic
1103710676 12:122910245-122910267 CCTCCCAGGCTCTACACAGTGGG - Intergenic
1104566574 12:129890341-129890363 CCTGCCGGGCCCTACACCATAGG + Intronic
1105433838 13:20360636-20360658 CCTACTATGCGCCACACACTGGG + Intergenic
1107861893 13:44669088-44669110 CATTCCATGCCCCTCACAATTGG - Intergenic
1109712734 13:66181237-66181259 CTCAACAGGCCCCACACCATTGG + Intergenic
1110527493 13:76555904-76555926 CCTACTATGGCCCACACAAGTGG + Intergenic
1114674988 14:24434209-24434231 CCAACCAGGTCCCACACAACTGG - Intronic
1115048726 14:29029402-29029424 CGTTCCAGGCACCACACAATTGG + Intergenic
1115130636 14:30048857-30048879 CTCAACAGGCCCCACACCATTGG - Intronic
1116114402 14:40629464-40629486 TCAACCAGGTCCCACACAGTTGG + Intergenic
1116200509 14:41788420-41788442 CATATCTGGCCTCACACAATTGG - Intronic
1117207908 14:53463552-53463574 CCTAAAAGGCCCTACACAGTTGG + Intergenic
1121928275 14:97948847-97948869 CCAACCAGGTCGCACACAAACGG - Intronic
1122061412 14:99138982-99139004 CCGTCCAGGCCCCACACAGCTGG - Intergenic
1122128757 14:99593148-99593170 CATTCAGGGCCCCACACAATCGG + Intronic
1124142397 15:27088764-27088786 CCCACCAGGCCCCTCACAATTGG + Intronic
1129162723 15:73755685-73755707 CCTACCAGGCACCAGGCACTGGG + Intergenic
1130063883 15:80589278-80589300 ACTGCCAGGCCCCATCCAATAGG - Intronic
1130350032 15:83083322-83083344 CTTACCAGGTCCCACCCACTAGG - Intergenic
1131155519 15:90072991-90073013 CCTACCCGGCTCCCCACAAAGGG + Intronic
1132703697 16:1232188-1232210 CCTCCCAGGCCTGACCCAATCGG - Intergenic
1132704812 16:1239173-1239195 CCTCCCAGGCCTGACCCAATCGG + Intergenic
1132707821 16:1254207-1254229 CCTCCCAGGCCTGACCCAATCGG + Intergenic
1133604582 16:7373765-7373787 GCCACCAGGCCCCACACTTTGGG + Intronic
1135359054 16:21795889-21795911 CTTCCCAAGCCCCACACACTGGG + Intergenic
1135457606 16:22612326-22612348 CTTCCCAAGCCCCACACACTGGG + Intergenic
1138416151 16:56872527-56872549 CCTCCCAGTGTCCACACAATGGG - Intronic
1141882666 16:86870123-86870145 CAAACCAGGCCCCCCACAACTGG - Intergenic
1142010193 16:87709957-87709979 CCCACCAGACCCCACACACAGGG + Intronic
1142467750 17:145849-145871 CCTTCCAGGCCCCACACAGCTGG - Intergenic
1147006455 17:37407311-37407333 CCTAGCAGGCCCCCCAAAGTAGG + Intronic
1147649084 17:42051706-42051728 CCTTCCAGTCCCCTCACAATTGG + Intronic
1149431080 17:56595968-56595990 CCTGACAGGCCCTTCACAATGGG + Intergenic
1151722698 17:75866746-75866768 CCTCACAGGCACCACACAAACGG - Intergenic
1152517861 17:80836727-80836749 CCTAACAGCCCCCTCCCAATGGG - Intronic
1153682551 18:7514295-7514317 ACTACCAGCCCACACTCAATGGG + Intergenic
1155177777 18:23315810-23315832 CCTCCCAGGCCCCAGTCAGTTGG - Intronic
1155256460 18:24002108-24002130 CCCACAAGACCACACACAATGGG - Intronic
1161840757 19:6679056-6679078 CCTACCACCCACCACACAATTGG + Intronic
1163000990 19:14367076-14367098 CCTGCCAGGACCCACAGGATGGG + Intergenic
1163576534 19:18114110-18114132 CCTTCCAGGCCCCACAAACATGG + Intronic
1164097838 19:22027717-22027739 CATACCTGGACCCAGACAATAGG - Intergenic
1164200798 19:23016734-23016756 CATACCTGGACCCAGACAATAGG - Intergenic
1164302839 19:23977085-23977107 TCTCCCAGGCCCCACATATTTGG - Intergenic
1164852123 19:31492627-31492649 CCGACCTGGCCCCACAGACTGGG - Intergenic
1165972161 19:39640579-39640601 ACTTCCAGGCCCCACACACATGG - Intergenic
926423446 2:12719441-12719463 CCCACCGGGCCCCAGACAAGTGG + Intronic
928073977 2:28246142-28246164 CTTACCTGGCCCCACACTGTAGG - Intronic
933191262 2:79336673-79336695 CTTACCAGGATCCACACAATTGG - Intronic
933390552 2:81661156-81661178 TCTACCAGGCCCCGCATTATGGG - Intergenic
938449555 2:131405000-131405022 CCTAACAGGCCACACACCATCGG + Intergenic
939497119 2:142937345-142937367 GCTACCAGTCCCCACACAGGAGG + Intronic
940894101 2:159063849-159063871 CCTACCAGGCCACTCAGAATAGG - Intronic
945046937 2:205789806-205789828 CCTACCAGGCTCAACAGAAAAGG + Intronic
948385658 2:237579065-237579087 CCTGACAAGCCACACACAATGGG - Intronic
1168924623 20:1569118-1569140 CTTACCAGGGCTCACTCAATAGG + Intronic
1171988985 20:31681117-31681139 CCTACCAGGCCCCACACAATCGG - Intronic
1174353845 20:49985681-49985703 CCTCCCAGCCCCCACCCACTGGG - Intronic
1175375520 20:58521095-58521117 CCCACCAGGCCCCACACTGAGGG - Intergenic
1175845692 20:62057638-62057660 CACACCAGGCCACAGACAATGGG + Intronic
1175845711 20:62057712-62057734 CACACCAGGCCACAGACAATGGG + Intronic
1175845730 20:62057786-62057808 CACACCAGGCCACAGACAATGGG + Intronic
1175845748 20:62057860-62057882 CACACCAGGCCACAGACAATGGG + Intronic
1175845765 20:62057933-62057955 CACACCAGGCCACAGACAATGGG + Intronic
1175845784 20:62058007-62058029 CACACCAGGCCACAGACAATGGG + Intronic
1175845801 20:62058080-62058102 CACACCAGGCCACAGACAATGGG + Intronic
1175845818 20:62058153-62058175 CACACCAGGCCACAGACAATGGG + Intronic
1175845837 20:62058227-62058249 CACACCAGGCCACAGACAATGGG + Intronic
1175845854 20:62058300-62058322 CACACCAGGCCACAGACAATGGG + Intronic
1175845872 20:62058374-62058396 CACACCAGGCCACAGACAATGGG + Intronic
1175845890 20:62058448-62058470 CACACCAGGCCACAGACAATGGG + Intronic
1175845907 20:62058521-62058543 CACACCAGGCCACAGACAATGGG + Intronic
1175845924 20:62058594-62058616 CACACCAGGCCACAGACAATGGG + Intronic
1175845943 20:62058668-62058690 CACACCAGGCCACAGACAATGGG + Intronic
1175845962 20:62058742-62058764 CACACCAGGCCACAGACAATGGG + Intronic
1175845979 20:62058815-62058837 CACACCAGGCCACAGACAATGGG + Intronic
1175845996 20:62058888-62058910 CACACCAGGCCACAGACAATGGG + Intronic
1175846013 20:62058961-62058983 CACACCAGGCCACAGACAATGGG + Intronic
1184796547 22:46736597-46736619 CCCACCAGGGCCCACACACAAGG - Intronic
949417661 3:3831296-3831318 CTCACCAGGCCCCACACCACTGG + Intronic
950112891 3:10431768-10431790 CCTACCAAGCGCCAGACACTGGG - Intronic
951794127 3:26518672-26518694 CCTACCAGGCCCCTCCCATTGGG - Intergenic
953929258 3:46997804-46997826 CCTTTCAGGCCCCACTCAAGTGG - Intronic
954385883 3:50243523-50243545 CCTACCAGCACCCACTCACTGGG + Intronic
955317058 3:57947918-57947940 CCTACAAGGTCCTACACAATTGG - Intergenic
956620941 3:71221065-71221087 CCTAACAGGCCCCAGACCCTTGG - Intronic
956718462 3:72098528-72098550 GCTCCCAGGCCCCACAGAACCGG - Intergenic
962633161 3:137300296-137300318 CCTACCTGCCCCCACAGAAGTGG - Intergenic
968447943 4:661910-661932 CCTACCTGGCTCCACCCCATAGG + Intronic
969707218 4:8818612-8818634 CCTGCCAGGCCCATCACAAATGG - Intergenic
972661980 4:41125061-41125083 CATTCCAGGGCCCACACAACAGG - Intronic
976095775 4:81506814-81506836 TCAACTATGCCCCACACAATAGG - Intronic
976351800 4:84068210-84068232 CCTATCTGACCCCACACCATGGG + Intergenic
977298926 4:95245035-95245057 CCAACCCGGCACCACTCAATGGG - Exonic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
978093634 4:104748171-104748193 CCTACGAGTCCCCATAAAATTGG + Intergenic
978944843 4:114482722-114482744 CTTACCAGACACCACACACTAGG - Intergenic
986741958 5:10712423-10712445 CCTTCCAGGCCCCACTGAAGCGG - Intronic
988056622 5:26105677-26105699 CTCAACAGGCCCCACACCATTGG + Intergenic
988531433 5:32030809-32030831 CCTGCCAGGCCCCACCCCCTTGG + Intronic
990530989 5:56673524-56673546 CCTACAAAGCCCCACACAACTGG - Intergenic
991445242 5:66692714-66692736 CCGACCAGAGCCCTCACAATGGG - Intronic
992114677 5:73528073-73528095 ACTAACAGGTCCCACACAAAGGG + Intergenic
992885708 5:81157846-81157868 CCCACCAGGTCCCTCCCAATAGG + Intronic
993210595 5:84945671-84945693 CCTCCCCAGCCACACACAATAGG + Intergenic
993311069 5:86332473-86332495 CCTCCCAGGCCCCTCAAACTTGG + Intergenic
994321654 5:98401672-98401694 CCTTCCAGGCCCCTCTCCATAGG + Intergenic
995269626 5:110205881-110205903 CTTGACAGGCCCCACACAACTGG + Intergenic
998099221 5:139418103-139418125 CCTCCCAGGACCCAGACAATGGG + Intronic
1001924749 5:175627970-175627992 CCTACCATGCCCCACACACTGGG - Intergenic
1002304375 5:178274605-178274627 CCTCCCCTGCCCCAGACAATAGG + Intronic
1006377418 6:33679255-33679277 CCTACTATGCGCCACACACTGGG - Intronic
1007097314 6:39221513-39221535 CCTACCAGGTGCCAGACATTGGG - Intronic
1007727256 6:43923993-43924015 CCTGCCATGCTCCACACAATGGG + Intergenic
1013423897 6:109993121-109993143 CCTACCAGGGCTCACTCACTGGG + Intergenic
1015605943 6:134954756-134954778 CCTGTCAGGCCCCACGCATTTGG - Intergenic
1025904103 7:65770567-65770589 CCTACCAGGCGCCAGCCAGTAGG + Intergenic
1026782642 7:73280163-73280185 CCTCCCAGGCCCCAGAAACTTGG - Intergenic
1027023406 7:74832988-74833010 CCTCCCAGGCCCCACAAACTTGG - Intronic
1027064525 7:75112330-75112352 CCTCCCAGGCCCCACAAACTTGG + Intronic
1029868160 7:103658730-103658752 CTTTCCAGGCACCACACCATTGG + Intronic
1032787400 7:135211612-135211634 CCTACCAGCCCGCACGCACTGGG + Intergenic
1034063360 7:148113443-148113465 CCCACCAGGCCCCACAACATTGG + Intronic
1035604987 8:924433-924455 CCTAACAGTCACCACACAACAGG - Intergenic
1036476867 8:9101491-9101513 CCCACCAGGCCCCTCCCCATGGG + Intronic
1037677620 8:21065396-21065418 CCTAGCATGCCCCAGACACTTGG - Intergenic
1042026936 8:64433778-64433800 TCTTCCAGGCCCCACTCAAGTGG - Intergenic
1043172546 8:76983406-76983428 CCCACCATGCCTCACACCATAGG - Exonic
1046483956 8:114860726-114860748 CCTGCCATGCCCCTGACAATGGG + Intergenic
1048027601 8:130601139-130601161 TCTACCTGGCCCCACACCATAGG - Intergenic
1049801468 8:144519636-144519658 ACTACCAAGCCACACACAAGTGG - Exonic
1049932392 9:469910-469932 CCTCCCAGGCTCCACTCCATCGG + Intergenic
1056546192 9:87615951-87615973 CCAACCAGCCCACAGACAATGGG - Intronic
1060200002 9:121646673-121646695 CACACTAGGCCCCACACAATGGG - Intronic
1061291983 9:129655587-129655609 CCTAACAGCCCCCACAGGATTGG + Intergenic
1061958375 9:133975350-133975372 CCTACCTGGCCTCCCACACTTGG + Intronic
1062315643 9:135965765-135965787 CCTCCCAGGCCCCACTCTCTGGG + Intergenic
1189886007 X:45545710-45545732 CCCACCAGGCCCCACCCATTGGG + Intergenic
1192905622 X:75547374-75547396 CCACCCAGCTCCCACACAATTGG + Intergenic
1193447096 X:81618360-81618382 CTTGACAGGCCCCACACAACTGG - Intergenic
1197245106 X:124159413-124159435 CTCAACAGGCCCCACACCATTGG + Intronic
1197631802 X:128869460-128869482 CCTACAAGGCCCAACATGATTGG - Intergenic
1197709068 X:129653504-129653526 CCTGCCTGGCACCACACAAGGGG - Intronic
1198793352 X:140369893-140369915 CCTACATGGCCCCACAGATTTGG - Intergenic
1200363549 X:155636428-155636450 CCTACCAGGTAACACAAAATGGG + Intronic