ID: 1171991391

View in Genome Browser
Species Human (GRCh38)
Location 20:31699236-31699258
Sequence GGGTGTTCCACCTGTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171991391_1171991398 19 Left 1171991391 20:31699236-31699258 CCCTGCAGACAGGTGGAACACCC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1171991398 20:31699278-31699300 AAGAGACTTGCAGAGCAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 397
1171991391_1171991399 23 Left 1171991391 20:31699236-31699258 CCCTGCAGACAGGTGGAACACCC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1171991399 20:31699282-31699304 GACTTGCAGAGCAGGAAGGAAGG 0: 1
1: 1
2: 2
3: 43
4: 410
1171991391_1171991397 15 Left 1171991391 20:31699236-31699258 CCCTGCAGACAGGTGGAACACCC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1171991397 20:31699274-31699296 TCTGAAGAGACTTGCAGAGCAGG 0: 1
1: 1
2: 3
3: 19
4: 210
1171991391_1171991401 25 Left 1171991391 20:31699236-31699258 CCCTGCAGACAGGTGGAACACCC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1171991401 20:31699284-31699306 CTTGCAGAGCAGGAAGGAAGGGG 0: 1
1: 0
2: 4
3: 63
4: 562
1171991391_1171991400 24 Left 1171991391 20:31699236-31699258 CCCTGCAGACAGGTGGAACACCC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1171991400 20:31699283-31699305 ACTTGCAGAGCAGGAAGGAAGGG 0: 1
1: 1
2: 2
3: 50
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171991391 Original CRISPR GGGTGTTCCACCTGTCTGCA GGG (reversed) Intronic
902693315 1:18124005-18124027 GAGTGCTCTTCCTGTCTGCATGG - Intronic
904967359 1:34386212-34386234 GGGTTTTCCAGCTGTCTTCTTGG - Intergenic
906059077 1:42936577-42936599 GGGTGGTCCAGCCCTCTGCAGGG - Intronic
908018736 1:59877393-59877415 TGGTGTCCCACATGTCTCCAAGG + Intergenic
908702041 1:66912549-66912571 AGTTGTTCCACCTTTCTGGATGG + Intronic
909488148 1:76197296-76197318 GTGTGTGCCAACTGTATGCAAGG + Intronic
911466628 1:98262695-98262717 TGCTGTTCCATCTGTCTGGAAGG - Intergenic
912223692 1:107706909-107706931 GGATGTTCCACCTGTGTCCGAGG - Intronic
915824310 1:159058546-159058568 GGATGGTCGACCTGTCTCCATGG - Intergenic
920455997 1:206101555-206101577 CTTTGTTCCACCTGTCTGCAGGG - Intronic
921056238 1:211544769-211544791 GGGTGTTCCACCTGTGGTCAGGG - Intergenic
1062791442 10:308891-308913 GGGTGTCCCAACAGCCTGCATGG - Intronic
1064992204 10:21266043-21266065 GGCTTTTCCACTGGTCTGCAGGG - Intergenic
1066369871 10:34811440-34811462 GGGTGAGGCACCTGCCTGCAGGG - Intronic
1066746367 10:38606017-38606039 GGGTGTTCCTGCTGCATGCAGGG + Intergenic
1070830034 10:79412462-79412484 GTGTGTTCCACCCATCTCCAGGG + Intronic
1074533392 10:114311921-114311943 GGCTGGTCCACCTGTCTGATGGG - Intronic
1076529607 10:131135800-131135822 GGGTGCTCCACCCTTCTGAAAGG + Intronic
1076751463 10:132545525-132545547 GGGTGTTCCCGCTGTCTCCTGGG + Intronic
1078939342 11:15984355-15984377 GGCTGTTCCGCCAGTCTGGAAGG - Intronic
1079005747 11:16790095-16790117 GGGTGGTCCACAGATCTGCAGGG - Intronic
1082974416 11:59058287-59058309 GGCTGCTCCACCTGTCTTTAGGG - Intergenic
1082978825 11:59102080-59102102 GGCTGCTCCACCTGTCTTTAGGG - Intergenic
1083309945 11:61779012-61779034 GGCTGTCCCACCTGCCTGAATGG - Intronic
1089590426 11:119536884-119536906 GTGTGTTCCATCTGTGTTCATGG + Intergenic
1092824404 12:12384954-12384976 GGGTTGTCCATATGTCTGCATGG + Intronic
1093066090 12:14659795-14659817 ATGTGTACCACCTGTCTGCCAGG + Intronic
1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG + Intergenic
1097246677 12:57611179-57611201 CGGGGTTCAGCCTGTCTGCAGGG - Intronic
1099768406 12:87020766-87020788 GGGTGTTCCAAATGTCTGGATGG - Intergenic
1104441621 12:128797879-128797901 GGCTGTGCCCCCTGGCTGCATGG - Intronic
1105765784 13:23557752-23557774 GGGTGTGTTACATGTCTGCATGG + Intergenic
1105766101 13:23560786-23560808 AGGTGCTCCTCCTGTCTCCATGG + Intergenic
1114371791 14:22097588-22097610 GTGGGTTCCACCTGTCACCATGG - Intergenic
1116962272 14:50978493-50978515 GGCTGTTCCCTCTGTCTGGAAGG + Intronic
1120834676 14:89028913-89028935 GGTTGTTGCCCTTGTCTGCAGGG - Intergenic
1123451877 15:20372297-20372319 GGGTGATCCCCCTGTCACCAAGG - Intergenic
1127045991 15:55026176-55026198 AGGTCTTCCATCTGTCTGGAAGG + Intergenic
1127783951 15:62339864-62339886 GGCTGCTCCAGCTTTCTGCATGG - Intergenic
1130467472 15:84199873-84199895 GGGTGTGCCACTTGTCCCCAGGG - Intergenic
1130496788 15:84473662-84473684 GGGTGTGCCACTTGTCCCCAGGG + Intergenic
1130788675 15:87128127-87128149 GGGTGCTGCGACTGTCTGCAGGG - Intergenic
1132184635 15:99792483-99792505 GGGTGTGCAACATCTCTGCAGGG + Intergenic
1132432348 15:101772173-101772195 GGGTGTGCAACATCTCTGCAGGG - Intergenic
1133420031 16:5638249-5638271 GGCTCTTCCACCTGTCTGGGTGG - Intergenic
1133941916 16:10316485-10316507 AGTTGTTCCACCTTTCTGGATGG + Intergenic
1137822657 16:51460578-51460600 GGGTGTCCATCCTGTCTGCTGGG - Intergenic
1140897994 16:79342161-79342183 GGGTGTGCCACCTACCTGCCGGG - Intergenic
1141182424 16:81763383-81763405 GGAAGTTCCAGCTCTCTGCAAGG + Intronic
1141404168 16:83777132-83777154 GGCTGGTCCGCCTGCCTGCAGGG + Intronic
1141466696 16:84210782-84210804 AGGTGATCCACCTGCCTGCTGGG + Intergenic
1141646695 16:85371412-85371434 GGGTGTGCGTCCTGGCTGCAGGG + Intergenic
1141774187 16:86111271-86111293 GGGTCTTTCACCTGTCTCCAGGG + Intergenic
1146842572 17:36166152-36166174 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146854884 17:36254111-36254133 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146865736 17:36334265-36334287 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1146870784 17:36378003-36378025 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147068606 17:37934877-37934899 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1147073668 17:37978627-37978649 GGGTGTTCAGCCTGCCAGCAGGG + Intronic
1147080128 17:38014414-38014436 GGGTGTTCAGCCTGCCAGCAGGG - Intronic
1147085189 17:38058165-38058187 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1147096077 17:38138374-38138396 GGGTGTTCAGCCTGCCAGCAGGG - Intergenic
1147101135 17:38182131-38182153 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147787527 17:42990332-42990354 GTGTCCACCACCTGTCTGCAAGG - Exonic
1148085717 17:44992740-44992762 GAGAGCTCCACCTGTCTGCCAGG + Intergenic
1148816653 17:50332893-50332915 GTCTGTGCCACCTGTCTGCCAGG - Intergenic
1149837493 17:59926535-59926557 GAGTTTTCCACCAGTCTGAAAGG - Exonic
1150081853 17:62247031-62247053 GAGTTTTCCACCAGTCTGAAAGG + Intergenic
1152146606 17:78572378-78572400 AGGTGTCCCACCTGTCAGCATGG - Intronic
1157009809 18:43633494-43633516 GGGTGTTGTCCTTGTCTGCATGG - Intergenic
1158043566 18:53127445-53127467 CGGTGTTCTCCCAGTCTGCAGGG + Intronic
1159778539 18:72632885-72632907 GGGTGTGGGACCTGCCTGCAAGG - Intronic
1160705645 19:528971-528993 GGGGCTTCCACCTGCCTGCTTGG - Intergenic
1160798048 19:954776-954798 GGCTGTTCCTCCCGTCTGCGAGG - Intronic
1162052701 19:8044322-8044344 GGGCATCCCACCTGTCTCCAGGG - Intronic
1163088067 19:14997267-14997289 AGTTGTTCCACCTTTCTGGATGG + Intronic
1167381591 19:49141408-49141430 GGGTGTTCCAGCTGGAGGCAGGG - Exonic
925490250 2:4383481-4383503 AGTTGTTCCACCTTTCTGTACGG + Intergenic
928295238 2:30077003-30077025 GAGGGTTCCAACTGCCTGCAAGG + Intergenic
940361697 2:152803102-152803124 GTGTGTTCTACCAGTCTGGAAGG + Intergenic
941887984 2:170549246-170549268 GGGTTTTCTTCCTGTCTACAGGG + Intronic
942427257 2:175873149-175873171 GGGTCCTCTGCCTGTCTGCAGGG - Intergenic
944789787 2:203113225-203113247 GGGTGTCCCACATCTCTGGAGGG + Exonic
945017781 2:205537552-205537574 GGGCCTTCCACCAGTCGGCAGGG + Intronic
947916242 2:233833653-233833675 GAGTGTCCCATCTGTCTCCAGGG + Intronic
1169539321 20:6582082-6582104 GGCTGTTTCCCCTGTCTGGAAGG - Intergenic
1171481820 20:25460359-25460381 GGGTGACCCACATGGCTGCAAGG + Intronic
1171991391 20:31699236-31699258 GGGTGTTCCACCTGTCTGCAGGG - Intronic
1172969547 20:38863355-38863377 GGGAGTTAAACCTGTCAGCAGGG - Intronic
1173409320 20:42795593-42795615 GGCGGGGCCACCTGTCTGCAGGG - Intronic
1175620072 20:60436119-60436141 GGCATTTCCTCCTGTCTGCAAGG + Intergenic
1175781618 20:61685803-61685825 GTGTGTTCCAGGTTTCTGCAGGG - Intronic
1179675217 21:42975751-42975773 GGGTGTTCCACCTGTGTGTGGGG + Intronic
1183618445 22:38959156-38959178 GGGGCTTCCTCCTGCCTGCAGGG - Intronic
1183623642 22:38989054-38989076 GGGGCTTCCTCCTGCCTGCAGGG - Intronic
1184591184 22:45484458-45484480 GGGTGTCCCACCTATCAGAAAGG - Intergenic
1184689175 22:46109743-46109765 GTGTGCACCGCCTGTCTGCAGGG + Intronic
949848668 3:8398622-8398644 TGATGTTCCTCCTGTCTGTATGG - Intergenic
950740811 3:15050532-15050554 GGGCGTTCTACTTGGCTGCAAGG - Exonic
953480225 3:43245158-43245180 GGGTGTTCCACCAGTAGGCGGGG - Intergenic
954272344 3:49519581-49519603 GGGTGTTCCGCATTTCTGAATGG + Intronic
956165561 3:66395882-66395904 GGCTGTTCTGCCTGACTGCACGG - Intronic
960595611 3:119405397-119405419 GGGTGTTGTCCTTGTCTGCATGG + Intronic
961733296 3:128983752-128983774 GGGAGAGCCACGTGTCTGCAGGG + Intronic
964836640 3:160946486-160946508 GGTTTTTCCACCTATCTGCAAGG - Intronic
965454660 3:168883246-168883268 GGGAGATGCACCTGTCTGCCTGG + Intergenic
968833647 4:2947106-2947128 GTGTGTACCTCTTGTCTGCATGG - Intronic
970395510 4:15661204-15661226 AGGTGTTTCCCCTGTGTGCAAGG + Intronic
971508881 4:27399331-27399353 GGGTGTTTCACAAGTCTGCTTGG + Intergenic
975717396 4:77218093-77218115 GGGTGTGCAACCTATCTACATGG + Intronic
980702034 4:136443219-136443241 ATGTGTGCCAGCTGTCTGCAAGG - Intergenic
985365857 4:189231972-189231994 GGGTGTTCCAGGTGGCAGCATGG + Intergenic
985787365 5:1904351-1904373 GGGTCTTCCATGTGTCTGCTGGG - Intergenic
987552743 5:19405154-19405176 GTGTTCTCCACTTGTCTGCAGGG - Intergenic
989790811 5:45399104-45399126 GGGTGTTCTCCCTGCCTGCATGG + Intronic
995060691 5:107808937-107808959 AGCTGCTCCACCTGACTGCATGG - Intergenic
999693947 5:154171760-154171782 GCTTGTTCCACCAGCCTGCAGGG - Intronic
1016781443 6:147963926-147963948 GGGTGGTCTACCTGTCTCCACGG + Intergenic
1018058482 6:160071690-160071712 GGGTGTTTCACTTACCTGCAGGG + Intronic
1019461195 7:1159874-1159896 GGGGGTTCGGCCTGTCTGCTAGG - Intronic
1020441746 7:8224274-8224296 GGGTGTTCCTGCTGCCTGGAAGG - Intronic
1022000240 7:26219202-26219224 GGGTGTTCCACCTGAGTGCTGGG + Intergenic
1031152524 7:118070783-118070805 GGCCGTTCCACCTGCCTGCAGGG - Intergenic
1033045296 7:137956793-137956815 TGTTGTTTCACCTGTCTGAATGG - Intronic
1034374205 7:150628590-150628612 GGGTGTACCCCCAGACTGCAGGG + Intronic
1035647256 8:1234191-1234213 AGGTGGTGCACCTGTCTGCTGGG + Intergenic
1036185754 8:6621464-6621486 GCGAGTGCCACTTGTCTGCAGGG + Exonic
1039567802 8:38563909-38563931 GGGTGCTCCTCCTGTGTCCAAGG + Intergenic
1040512666 8:48108711-48108733 GGGTGTTCTGCCTGACTGCTGGG - Intergenic
1043092234 8:75920031-75920053 GGGTTTTCCTCCTGTCTGTTGGG + Intergenic
1047446415 8:124924155-124924177 TGTTGTTCCATCTGTCTGGATGG + Intergenic
1053877303 9:42557907-42557929 GGGTGGGCCACCAGTCTTCAGGG - Intergenic
1054234390 9:62543815-62543837 GGGTGGGCCACCAGTCTTCAGGG + Intergenic
1057198664 9:93129018-93129040 GAGTGTTCCTCGTGACTGCATGG - Intronic
1058188059 9:101878622-101878644 GTTTTTTCCAGCTGTCTGCAAGG - Intergenic
1061573515 9:131492109-131492131 GTGTGGTCCAGCTGTCTCCAGGG + Intronic
1186182999 X:6990949-6990971 GGGTGTTTTGCCTCTCTGCACGG + Intergenic
1188094546 X:26005292-26005314 AGTTGTTCCACCTTTCTGGATGG + Intergenic
1188473272 X:30563581-30563603 GGGAGTGTCACCTGGCTGCATGG - Intronic
1188854626 X:35177923-35177945 GTGTGTCCCTGCTGTCTGCAAGG + Intergenic